Description :
From Genome Similarity Track
Location :
Scaffold_254:17240- 18473
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_254-abinit-gene-0.20Conserved gene of unknown function

Sequence
1233 bases(100 bases per row)
ATTGAACCTGGGAACCAGGATGACGACTCGCGCCAATAGACGAGAACTCTTGCTCCATGCAGTCGAAGCAACGCCGCATCCCCGCCATCCTGTGCAGAAC
AATCGGGAAGCGCCAACTGGAGCTGCTGGAACGCCTCGGATCTGAATGAGAACGCCTCGGGAGCGAAGCGCATGCGCTCTCCAGCCTATCAAACTCAATA
CAGTCAAGAGCTACAGGTAGTCAAAGTCCGAGTGTGATCTGAATTCAGAGTACTGTACCTCCCAGGCCTCTTCTCCGTCGTCGTACTGGACAAAGAACTG
CCCGTTGAGCGCGTCGTCAGCTTGAGCCACGCGTCCAGCGAACCATTCGCGCTCCTCTATCCAGTAGACCTGCACAAGGTCGCCACTCACGAAGTGCCAG
CCGCTACGAGGAGCGAGAGGAAGCCCTGGAGCTGGGTGCACTGCTGTTGTGACCTGACTGCCATCGCCACCACCAGAAGTGCCGCTGCTGCTGCTGGAGT
ACTCGAACGAGTCCGAGTACTCGTCGAACTCCTCGTCTTCGTAGACAGCGGACTCGTCCTCAACCAGCGCGTCGCTGCTGTCAACAAACTCGTCACTCGA
CATTGTTTTTGAGAAACCGTTTTGGCAACCTCATAAACTTAGATAGTTAGAACATCCCCAGCGGTTCACGGCAAACGGTACATTACATACAAAAAACAAG
TTAAAATGATGCTCAAATTTCATAAATTGGACCACAACACCATGGTTTGAAGGTCTTTGGTTTTTGAACCCAAAGAAAGACCTTCCCGCCCAAATTTTAA
AGGGAAATCCAGCGCCGTGTGTTGCCGTCATGCTCTCTGTTCATTCAGATTTCTCCATCATACAAGAAATGGCGCGAGGTGCGCAGTTGTCGCCAGATCT
GCACGACCTGTGCACCAAGAAGCGCAAAGGATTGTCTTACGCAACGATCGCCGAGTGGATGGAGTTACCTCTCAGCATCGTGAAGTCGCTGTGCCGGCGC
GCCTGCCAGAGCTGCCGTGACAGCTGCGCAACGTTGCAAGGGCGTCCGCGCCTGATGGACGAGGCGATCGACCAGCTGATCGTGTCGTGGGTGCTGAAGG
ATTAACGCTTCTCTGCACGGCATATCCATACCGAGCTGCTGCTGAAGAAAAGCGTTGTCGGCAGATCAACAATCCGCAACAGGCTGCGTGATGCTGGCCT
GCACGCGCGCATTGCTCGCCGGAAGAACATGGT