Description :
From Genome Similarity Track
Location :
Scaffold_658:1724- 4114
Sequence
2390 bases(100 bases per row)
GGTGGCGAGTGCAAAGCATTCAGCACTGCTGAAGGCACCTCGCCCACCTATCAACGGTGATACACCAGCCGCCAAGCGCGTTTTCGACCGCGTACAAGCG
CTGATGCAGAATGATGAGTGGATGCAGCTGTTCAAGCCCATCCCCAAGAAAAAGGCCGACTGGCCTGCGCTTGCGCAGGAACTTCAATACCCAGTCAACT
CGGTTTCGACTAGTCAAGTTGCCGAGGATTCAGTTTCGCTACTGTTGTCGCTGGGGTTCGAGAACGAGACGTACCCATCGACGATGTCGCTCCAGGATTG
GAGTCCACATGAAGCCGGAGCTGCTCTCCAGAAATGGAAGAAGAAGCTTCGGAAGGCGTTTGGCGCCGTTGGCATCAATGCCGGAAAGCAGCCTGTGAGT
CGACCGATGATTCAAGATGAAGATCCGTCTAAGATTCCACTGCCGCCGACGCCCCAACGACTCGTTCGTACTCCTCCGACCAAGCGTGGAGCTGAGCGTG
GTGCCTTTGGCACTACCGAAGCTTCACCGTACTTTCAAGACTCGCACATGGTTACGCCACGTTCGGAGAGCCGTATGCAACGTATTTACGCAAGTAACGA
GGGTTCGTTCGGGTCGCCGAGGCGGTGCGCGAGCTCCCAAAAGTGGTGCCGGACGTCGTCAAGTCGACAGCGATGGGTTCGTCCAGTGACGATGACATTT
TGGTGCGTACATTCGCCGAGGAAGATCCTCAACTCGAGTTGATGCGTCAGATGAATGAGCTAGCGACGCTGAATCGACTGGGACCCGACCCAGAGGATTG
AAATGAATTCCTCACCGGCCTCATGGGATCGGATACAGGCCAGCTCCCAGGGTCTCGCCACTCATACTCACAAATCGAAATGGCAGCGCCCTCCGGGGGA
CAAGCAGAGAAAAGAGACTGGAGAAACAAACACGATATAGCGCTATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN