Description :
From Genome Similarity Track
Location :
Scaffold_1911:1724- 3026
Transcript NameFunction/comments
Phypl_g14369hypothetical protein PHYSODRAFT_511531

Sequence
1302 bases(100 bases per row)
TTACACGGAGGGTACCCTCCATCCAAACGTCAGCGGGTCACTTTCCATTCGACCCAGTAAGTGTATCACACGTCCGCCATGTCGGCCACGCCTCCCCCCT
CCGTGcccaagaagacggacgaGCGCCTGCTGTTCGCCGTGCCCAAGAAGGGCCGTCTGCACGACAAGATCATCAAGCTGATCAAGGGCGCGGGGCTGGA
CTACCACCGCCCCAACCGCGTGGACATCGCGCTGTGCTCGAGTCTGCCGGTCACGCTCGTGTTCCTGCCCGCCTCGGACATCGCCACGTACGTGGGAGAG
GGCAACCTGGACCTGGGCATCACGGGCCAGGACATCATCGCCGAGAGCCGgaccaaggtggacgagctcatgcaGCTGGGCTTCGGCCGGTGCTCGCTGG
GCGTGCAGACGCCCGTGAAAGACGCGATCGCGTCaccggagctgctggcgggcaAGCGCATCGTCACGAGCTTCCCGGGGGTTACGCGCGACTACTTCAA
GCAGTTCGAGACGGAGGCCACGGGCCCCACCAATATCAAGTACGTGTCGGGGTCCGTGGAGGCCGCGTGCTCGCTGGGTCTGGCGGACGGCATCGTGGAC
CTGGTGGAGACCGGCACGACCATGAAGGCCGCCGGGCTGGAGCTCATCTCCACCATCCTCACGACGCAGGCCGTGCTGATCGCCAACCCGCAGTCGAAGC
ACAAGGACCTGGTGCACAAGGTGCACCAGCGCATCCTGGGCTACATCACGGCCACCAAGTACCGGATGATCACGTACaacgtggacaaggagaagctgga
cgaggccaccAAGATCACCCCCGGACGCCGCTCCCCGACGGTCAACGGACTGGTGGGCGGCGGGTACGCGGTCTCGGCCATGGTCGAGGTCAAGGACGTG
TCGGACGTCAtggaccagctccacgacgtggGCGCCACCGACATCATGATCGTCAACATCGAGAAACTGCCATCGCGCTGGACGTTCCGAATCTCCATAT
CCCAGTGAGACAGAGTAACTCCCCACGGAACACATCGGCCGTCCGCAGACTTCGACTTGATTGCCCATTTCAGAACGGAGTATCTCGTATAGATGATCAG
AGGACAGCGGTCGGGAATTGTCTGAAAGACTTGCAACACGCGCGTGATCGCGATGACTTCCTTTTCAGCAATATGATATCTCAGCTCGGCGTCATTCAGA
ACGCGACCTGTATACCTCACTGGTTGGATGACTCCGTCATATTCCTGGCCTAGGACTACACAAGCGGCCCACTGGTTCGCATGTGGAATAATGGTGAACG
GC