Description :
From Genome Similarity Track
Location :
contig_11:1724- 2931
Transcript NameFunction/comments
g3168.t1OWZ00175.1 Integrase, catalytic core protein, partial [Phytophthora megakarya
g3169.t1hypothetical protein

Sequence
1207 bases(100 bases per row)
AGGAACGCAGTCTTGACATCCATCTGGTGCAGCTTGAGACCATACTTGGCAGCTAGACTCAGTACGATCCGGATGGACGTGAACTTGGCCACTGGTGCGA
AGGTCTCGTCGTAGTCGATGCCGTACTTCTGCGAAAACCCCTTGGCCACCAGTCGCGCCTTGAACCGCTCAATCTCTCCAGCTTGGTTCTCCTTCACGCG
AAATACCCATCTGCAGCCGATCGCCTTGCGTCCCTTCGGCAGTGGTACGACATCCCACGTGTCGTTCTTGAGCAGCGAGTCACACTCCGAGTCGCACGCC
TCCTTCCACTTGACTGCGTCGCTGGATTCCATCGCCGACTTGAACGTGGTCGGCATTTCTCCCACTGAATCCACGACGTACGCAGCTTCGAAGTCTTGAC
TTTCTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAG
GGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACT
GGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACCGTGGCGTAA
TCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCCATACCCTC
AATACGCCCCCTCAATGCGAAGTCCCATGAATGCCGAGAGCCGCCGTCAGCTCCGTGTGGCGTGGTCCCGCAAGCGCCTTAGTCATGATGTCCGCCAGCA
TCACAAAAGTCTCGCAATACTCGAGCTTCACTTCACCGCGTTTCACTTCGTCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGTGGCCGTGGTT
CACCGGGTTCTTGGTCATCTTGATGCTCGACTGGTTGTCTTCACGGATCATGAGGTCGGGTCCCGTGTCGTTGGCAGCCGCCAGAATCTCGCACAGCAGG
CGATGGATCCACTTGCCCTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCTTCGCTCGTGGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGC
TCACAGG