Description :
From Genome Similarity Track
Location :
scaffold_1:172389- 174547
Transcript NameFunction/comments
g57.t1 nardilysin, putative
g58.t1hypothetical protein

Sequence
2158 bases(100 bases per row)
GCGTGCGGATTCGGTCATTCTGCGTAGCTTGGCTAAATTCAGACTCGATAGCGGATAGTTCCCTCTCCATAGCTTCAGCCTTAAGCAGCGGCGAGATGAA
GAAGTGCGCGAACATGTCGAGAGCCGGCTCTAAATGCGCTGGACCCACTTCGAACGTGTAGCTGGTCACTTCATTGTCCGTAGCTCCATTACTGTAGCCT
CCGTGGGCGCTCAAAAAGGATTCAAACTCGTTCTCGTCCGGATACTTCTGACTGCCCATGAACAGCATGTGCTCCAGGTAATGGGCCAGACCGGGCAGCG
CTTCGGGCTCTGCGAAGCTTCCCACGCCCACAGTAAGACACGCGCCAGCCCTGCGACTGGGCGCTCCATCGCTCTCCTCTTCGCTGTCGTCGAAGCTGCT
GCCGTCGTCCTCTTCGCTCTCACTGAAGTCGCTGGCGCTGTCCTCGCCGCTAAAGTCGTCGTCGTCGTGTTGGCTCTGCTGGCTCTCGCTCTCGCGGGCT
ACGGCGGCCACTACATGGGCCACCTCGGCCGTGGAGATGAGAAGCGCCTGTAGAGAGTTGGGCAGTGTCAGCAGCCGGTACTTCTTCTGGTCATTGGGCG
ACTTGGACGCCTCCACGGGGTCGGCCATCGTCACCATAGCCTCCCTCGGATACAAGTTGCGGAATGATGACGATCACTCGATGGCCAATAGCAGAGCTTG
TAGGTTGGTAAAGTTTGTCCTAAAGTAGCCAATGATAGAGCTCTAAGATAGTCTTAGGTTCAATCTATGTAGGTTAACAGCTACAATAGCCACCAGCCAC
AGACGAATAAAGGAACGGAGTCCGAAGATGAAGCTCGGTCGCGGCATCAACGTGGAGCACATCAAGCGCATGACGCTGCGCACCATCCGCGACGGCACCG
AGGGAATGCCCGAGACGCTCGCGTTCCTGGACGCGCTGGAGCGCAACGACTTCGACGAGACGCAGTGCAAGCGCGAGGCACGAGGCATGATGCTTGTGCT
AGAGGCCAAGAGGCAGCGCCGCGCTGCCGAGCACCGCTCCACGCTCAACTTCCACGTCATTCGCATGATGAAGGGACACCACGATCCGCGTCGCTAAGGG
ACATACAAGACAGTGACAGGAAACTACAGGGAGTGGAGCTACGCAAGGGGCGAGGTTAGAACTGTATTTATCTAAGTGATAAACTTTCGCCGGCGTCACC
TTGTGCGGTGCCACGCGCCGTTTGTGCATGTTCTCGAAGTCGTGTTGCTTGTTCACTTGGCTTTGACGTGATTGATTTAGGTTTTTGCATCAGCAAATAC
TTCGAAGTAACGGTAAGAAACATGCTGGTGTTGTAGTGATTAGTACCAGTTCTACGATCAAGCTCCTTTGTGTAGTCCAGGCATCGGACGCTAGTTGCTG
GCAAAGATTAGCAAGCTTCCCACAAACCAACTTGGCAACAACCTCCAAACCTCCAAGAATTAATGGTCACTGCTTTGGACGTTTCAAGGCTGCCGGTGTT
CTACTTCCACGGTGTTCGCGGTTCACGAGACAATGCTGCTAGCTTTGCTTCAAATTTCATCGCTGAAGGCCGCAGTGTAGTGTAGTATCCTTTCGTGCTC
GCGAGATTCGAAGCTCACCTAAGTCCTGAATGCAATCGCTCAAATTCGCGAGACTGGTCAACAACTCTGAATTCGACGACGGCAACATTTTCGACCCACT
TGCAAGAGGTGCAATCGCGCGGTGTACATGTAATCGAGGAGATGGATTCAAGCGCTATGTCTGCAGTACGATCAGCTCATCGGGCTCGACAAGGTGCCAG
AAGCCACGTTCAACTACAACGCTTACCGGTCCAGAAGACTGCTACAGCAGGATGCAGACGGACTTCATCCCTTTCCCCACGAGAACCCACGGCACGCAGT
ACGAGGGGACCCAAATCGACAATAGTTACAGTTTCGCAGCTTCTCCACTGCCAAATTCTATACAACAACGTCAACCAATGTCTGCCGGCAACGACCAGTG
CATCTGCATGTAGAAACGTCGCAAGGCCATCTCCCTGAAGCTGGAGGAAGCTAACGACTCGTTACTCGGAGGTGGGCACTACTGAGGAGATCCAAACGCA
ATGAACTTGACTATTGTGAAGTTGAGAACACACTGGTTTGCAGACACCGGATGAGCGT