Description :
From Genome Similarity Track
Location :
Scaffold_538:17238- 18416
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_538-snap-gene-0.4Pre-rRNA processing protein
Pytve_DAOMBR484maker-pve_contig_538-fgenesh-gene-0.1Ku70/Ku80 beta-barrel domain-containing protein

Sequence
1178 bases(100 bases per row)
GACGGAAGACGGCACCCAAGTTCTACGACCCGGCCGCCGAGTTCCCTGGCGCGCAGTAACGTCTCCACCTATATAACCTGTTTCATGTTGATCCACCGGA
GCCTTACTCAAAGTCGGCGAACATATCGTCCTCGTCCTCGAGCGCTGCGACCTGCTGGGAAAGCGCGGCGGCAGCAGCGTCAGCACCAAGAGGCTCGTCA
CCGTACAGGAACGCGCGCGCCAGAGCTGGCGTGATGCTCACGCTCGGGTCGTCGTCGGAGCTGAGCAGCGTCACGCCCTCGCGCTTGACAGCAGCCCAGG
CGGTCGACTCCTCGGTCAGCGCGGCCTTGAGCTTGATGAGGAAGTCGTTGAACTCTTGCGCGTACTGCAGCTCGGGGCTACGCTTTCGGAAGTGGACGAG
GCATTGCAGCCCCTTGGCGTGGAACTCCGGCTCGCTCTGGCCCAGGAACTTCTCGATCTGCTCCTGCATGCCCGTCACGGCGCTCGTGAGTCGCTCGACT
CGGTGGCTCTTGGCGCGCGACACATCCACCAGCGTCTCAAAGTCGGCAATTGGGTTCATGGACCCGACGGACGTCACACCACCGCCAGCGTCCAGTAGCT
CGTCCAGATCCAGCTCTGCGTCCGACTCTTCACCGCCATCTTGGTCACCAGTCCCTCCATCTTCGTCTCCGGTTGTGTCTGTTGCACCCGCTGGAGCCGG
CACGTCGCTCCAGAAAGACTTCTTCTTCTTCTTCCCCTGCTCCTTGACGGCCTCGCGCAGCTGGAATGCGTCGCCGAAACTCGCAATCAGTTCGCTGAGC
TGCTCCTTGCGAGCTGGGTCCATGTTCAGATTCGAGTCAATGAACGGCGGAACCGGCGGGATCGGCGTGACTTCATCGAACGCGCGGGCTCGGACAGCGT
TGAAGAAGCGCGCCACCACTGGATTGAAGCACGAGCCAATGTCGTCAGCCTTCTCCGCGCGGATGCTCAGACTGTCCACAAGCTGGTCGGCGAGCTGCTG
CTGCTTGTCGGTTGGCGTCAGCTCGCGAGTCTTGAGTGGCGCGAACTCGTACGTGCGCACGTCTTCGTCGAACGGCAGCTGGTTCGACCACAGCGCATAG
TAGTTCTCGCCTCCCGAGTTTGATGTTGACGACGGCTTGTGCGGTACTAAAGCGACAATCTTGGGGGCCGCGTTCTTC