Description :
From Genome Similarity Track
Location :
contig_179:17234- 18424
Transcript NameFunction/comments
g13453.t1hypothetical protein

Sequence
1190 bases(100 bases per row)
TCAACTACAACCAGCAACAAGTTCAGTCAACTTTGACCTTCTCCGCGACCAGTTCCTTCGTAAATGCTCAAAAGGTTAGATTGTACGGATGCATCCGGAT
AGCATGAGAAGTGAGCTGACTCAGGACAAAAAAAAACACAATGTATCGAGGAACAATCTTAAACCCCAGGAGTTATAGCAAAACCAGGACGTGACAAATA
AACTACAGTGTACTTTTGCAATGCATGCGCTTTACCCGGAATTCACAATACATGCACTCCTATTATTTTAATATCATCTTAAACTACACGTATTGGTTAG
CTTATTGGTTTCCAAAGCTGAGAGGGTTGAGCCATTTTGAAGACAGTACATGTATAATAGTCACAATAGTACATGTATTATAGGTATATGTACACACATC
TGCCACGTTGTAACCACATGCCAGGGTCTCTTTTGTGTGCCGGGCGCACAGCAAAGGTAGAGCGGGTGTCCTTGTATGCTTGCCTACTGTTTGTCTGCAA
TCCGTCCTATCGTTAAGATGTGATTCGGAGACACGACGAGATGTGCTGCTTGATGCGGTACATGTACGGTACTGTAGTACCCCACGAATCGTCAATGCAA
TCATTGATAGCGTGCTCGAATTTTTAGAAAAGAGCAGTCTCTCACAGGACAGGTAAGATTAAAAATAATCTAAGATACTCTGAAATTAAACAATCACCAA
CTTTGGCACAAGCCGCTATTTTTCACAACTACATGTACTCGAGTTGGCCTCATTGTCCAGTACATGTACATGTATGTTTGACCCACCTTCCTTTGAACTA
CGACGTCACAGGTCACACAGATCACGGGAGTATATCGTATCGCATGCCTCTGGTCTAACAGCATGATAACTTTTAATGATCGGGTGCAAGCTGTCTCTTT
GTGTCGGACCCTCAAATGAGTCGCCTTGACGACCCGGAGGGATAGCCTAACCTACTCTTTTTCTCCGCTCCATTCCGCAATTCTTCCACCGAGACGCGAA
TCAACAAGCTCCAGGTGTGGAGATGAAGACCCACGTCGTCCTCTGCGCCGCTTTGGCTGCCATTGCCGTCGTACAAGGCCAAGAAACGTCCAAGACGACT
GTGAAGTACATCGACTACTCGTCCTTGAAGAATTTAACGAGAGCTCCGACTGTGCAGCAAGACACGTCGGGGTCTCAGGACCAGCAGCAA