Description :
From Genome Similarity Track
Location :
Scaffold_105:17232- 18695
Sequence
1463 bases(100 bases per row)
ACACCTTTGATCGATTTTAAGCCAATCAAGTGCGTGCGTCACAATAGTGACCTATCCAAAGAGTGCTTCTGAATATGCCTATATACCTATGAGAAGGGAA
CAGGCTTGATCGCACTTAGTACGTGTAAGGTACACCTAACCGCGTTATCTACAGACACACACAGAGATAAGTACGATTTAAAAATTCTGCACTCAACCTT
GCACACACTCACTAATAGCTTCACCGTTCGGGCTCGCAACAACCTTGCGCACACTCACTAATAGCTTCACCCTTCGGGCTCGCAATGAGCTAATTTACTT
GACCAGTGGCAATAGTTAATAATGTTTGGATCAATGGTTTTGACCATTGGCAATCATTGCAAGAGTGCCCGACCAATTGTTTATACCATTTTCAATGGTT
GTCAAGATGACTACACAATGGCTTGAGGCATTGACAATGGTTGCTAAGGATCTAAAGCAATGATAAATTATTATTGGCAACGGTTGTCTTGGATTAGAAA
CAATGAACGTAAACAATGTCAATAGTTTACGCAATGGTCCGACCTGTGAAGTTTTTGTTTGTTAAAAATCTTGCAGTCTTCTCTTAATACTGCGAACCTT
GCTTTGTCTTAAGCCAAAAAAACATGAGAACCGTTAACCTTCCCTCATTTTTCTGGTAGAATCCCCTCACTTCGATATACCGACACATGATTGGCTAATT
TATAGGCACGCCTTCAGGATATTATATCACTGTTACCGGTTTTTAAGCGTCAATTATGACCTAATTAAGTATCTTTCGTAATCTTTCTTTGGTGTTCTTT
AGCGCAAGGTTCTGTCAAGCTTTGCCTGCAACGTTCGCGGACTCGAAGCTTTTACGTCCGCAGATGCGCGCTACCGCGCACGTCTATTTAAATATCAACG
CTTCTACAGCAGCGAGCAATCCCCATCGCGCTAACATGCAAAGGCGTCTGCGCTAGTGAGTGGTAAGACTGCTTTTTTATTATTAATTTTGGAGCGTTTT
TGGCTTCGTTCGTGTCGCGTGCAAGCGACGCGTGTTATAATTATTTGTCTTATACGTTACTTTATAGATTCATTAATATCCCTGTGCTGTTCCTGGTCTG
TTGATATGAAATGTAGGTCCATACTAGAGCATGTTGGAGAACTTAAAGCGAACATGCACAAGGAGATTATTGACAAGCGCGCGCGTAAAGCTTAACTGAA
TCCTTCTATTATCTCGAAGATGTTAAGGCACTGCAACAAGGTGAAATGATGCTTCACGATAATCAAGTTGCTGATGCTGCCAATAAGGCCGAGGAAACTG
CATGCCCGTTTAAGCAAGATTCTGTTACAGTGGTGAATGAGTGATAGCAATAACAACGCTAATAAATTCGTACTCAAAAATGCAGACGAAGCTGTTTTGA
TCCATAAATTGATTTTAGTAAGTTTTGTGGGTGTTGGATCGATTAAACTTCCACATCGCCGTG