Description :
From Genome Similarity Track
Location :
scaffold_49:172304- 174616
Transcript NameFunction/comments
Plaha_PHALS_00629TFIIF-interacting CTD phosphatase%2C including NLI-interacting factor (involved in RNA polymerase II regulation)

Sequence
2312 bases(100 bases per row)
ATTTTGAATGGCGCTGTACTGACTGATCATGGTGATAACCACTGAATGTTGTATCTTCCTCGAATCTTGTCCCCAGAAACACTTAAACGTTAGACAACCC
AATTCCCCATCACCTCCTACTTATGATGATACTGTGTTTATTTTTGCTGGTCGCAGTAATTTTATTAACCATTTTCACCGTTTACACCGGTGAAATTCGC
TAGAGGAACTTACCATTGACCGCCAAACGGTTTATATGAAGTATCTTAGATTTTGTAtcgtgctcaaacggtctgGACGAAGTATTCGAAAATCTGAATC
GTAACGACGATGCATACGTTAAAAAACCCGAAGCGTACAGACATTATCACTTAACGTTTGAGAGCCACTGAGTATAATATTCAAAATAAATAGGCATTTA
ATCAaatacaatttcttgtctgaaTTTTGAACAGGAGTTACATACTTAGCAtgtaaaaattaaatttgccTTTGTATGTCAAGTTATTTTTTTGGTTGCT
AATTAATAAGGATAAAAACTATTTGAGATACAATCAGAAATGTGCACTCCAAAGGTGCAAGTGTTCACGAACGTCTTTCACATCCTGGATCTTATGAAGA
AAGCGTGCGATAGAATCGAGCTCGCAGTCATTTGGATCGTTGATAAAACTGGAGCAGCCGATGGCGTTACGAGGATGAAGAGCATATGCCATTGGCGAAt
tgtcgatgagaatggtttTGGAGATATCACGATTGAGAAGCGAAAGGTCCTTAACATAATTGCCCTTGTACTGAACACAATGCTCGCGATAAAGCCGGTA
GCTGATAGCACCATTCGGATCTAGCTTATTAAGCACTGGGTCTGCGTACGCGCTGAGGCTTGCTGTAAAGACAACAATTTCATAGGTTTTGGCCATATTA
GCCAGAAAGTTTTCGGCCCCAGGCCGCTTGCACACAAAGACGGTGTAGGCGGTACCGTCGAGGTCAATCAAAATGGTGTAGTCATGAGTGTCAGTTGATT
TGAACGATGAATGTACCAATGTTTCATCCAGATCCAAAATCAAACATTTTCTATTCACCTCACAAGGAGAGGTGGGAGGTAATAGACTCGGACGCAGCTT
AATGGTATTGCTGTTCAAAAGAGATTCTTTCTGTTTGTGTTTTTGATGATAGGGACCGAACACCGACTGAAAACTGACGAATCTGTTGTTGAGGCTCCCT
CGCTGCTGAGCTCTCATCGCATTTGATCTTTCGCTGAGTAAGCCACAGGAACTCGTAAGAATAGGCTGCTGCTTACCGTTTCTGTCAGCTTGATGAATGA
AGGTGGCCAACGGATTAACTGAATTCAGCTTTGTGAGCTTTTTAGTTGATAAAACGAATTCTCCTCTAGTTCTTTCGTCTGCAAGCGTGATATTGCTCCC
AAATTTTGACGATAGTCTTCCATTTCGGGACTGTTGCCAATTAATAGTTATCTCTTTCATCGTATTTGATCTTGTGCCAGTCATGGTCACCGACATTTAC
GTCGCGTTCTGTTTATTGATGGCGCTACTTTTTCTAGATTTGACCTCGCGCGACCCCGTCTAGAAATAATGGCACCGCGAAAGGCGAATTATGTCGTGGT
TCGTAAATTGGGCCGCTTGATATGATGGGCTGCGCGCTTTGTTCATTAAAAAATTGATGTCACTGCATTTGACCAGAATTAATGTTTTGTTTCTTGTCCT
CGCTGGTATCAAGCTGTTGGACAATCTTCATCCCTGATCAGCTGCTTGCATCCTATTAAGGTTATTTTTGCCTATCACGACACAATGCGGCACTTAGACA
GCAGTCTAAATCTGAAAAAATTCTGCTTACTTTGAAAATGTGAAATGCTTCTCACAACCGTCGAGCTTAAAGACTCATGGCCATTGCCAAAGTAGTTGCT
GTTTAGCATTTTTTCTTTTATAACTGCATCCTTATGTTCATCGTTCGAACCATAGCAGATGTGGGTCaagcaaagctttctctttAGATAAAGGCAATTT
TGAATTGCTATTTGTAACTTTAGCAAGTTAGGTAGCTCAGACTACTCCGTATTGCCCTGTCAAAGATGAGGGCTATCACGGTGAAACTGATTCATGAGAA
GAGGGAAATACCCCCTGGTGCTGGATCTCTTCAGTGCGGTGGATTTCCAGTTATCCGGACAAAATCTCCATTGGAGGCAATTTCATGAAAAGCTCTCTTC
ACGAAGGAGTGCATCATTTTTGTTCGAAATCTCCGTTAAACTCATTAAAGAAGCGGCAACGTGAAGCCTTAAGTAATGTCAAAAGGTTAACGTGGAATGT
TCATCGATACAT