Description :
From Genome Similarity Track
Location :
Scaffold_188:17230- 22545
Transcript NameFunction/comments
Hyaar_Emoy2812184hypothetical protein

Sequence
5315 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTCGTAGTCCGTTCAACGACCATGAACATGTTGGACGATGAGGGGGATGATTTTCATCCCGCGCATGAAATATACTCCCA
TTTGAGTCAAATCGAATGGGACGCTGTTGAACGCTCGAGTTCAACGATAGGACAAGAAGCCGTAGCGCACTGCTCTCCGCCCTGGGGACAGACGGACAGC
ACGCCACCATCTCCAAGTTCATTCAAAAGTAACCTTGCTTCACCACAAGGTTCTCAACAGACAGAGCTGTTGAGAGAACATAGTGCTCAACAGTTTGAGC
TGTTGAGACAGCAGCAGGCCACTGCTACCGGGTCGACCTGTATACGTCTACCTGAGACTCTAAAGATTGACATCTCAAAGTACAAGGGAGCCGATGAAGA
CTCTCTGTTGAGATGGTTCGTGGAACTAGACGATGCCATAAGGGCTCGTCATATCGTCGATGAGGAAATGCAGATCGCATTTGCTCAATCGAACTTGGCA
GGGCGTGCAAAGACGTGGGTCTTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTCGTTGAAAGTCTTCAAGTCCCTACTAAGGCAAACTTTTGAGC
CGCCACGAGCGGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATCAAGCAAGGTAAACGTGACGCACACTCGTACATTCAGTACATACGTCACCGTACCAG
TTGCATAACAGTCGACCCACTGAACCAACAAAAGTTGATTACATTGTGCATGCAGGGTCTGACTGATGGTCCAGTTAAAACCTACCTGTTCCGATGTTCC
GATTGGAGTTCAATACCCTAGAACAATAAGGGTTGCGGAACAGGAGGACTCAGCGTGAAACAGGCTTACGCGAATTCGAATTCCTATCGTCCGTCGAGAC
GACAGGAAAATGGAGGCCCAGAACCCATGAACCTCTGTAACACGAGGCGCGAGAGCTCTCGTGTTAACAACTATAAGAAATTGCAAAAATGCAATAGATG
TCAGAAGACAGGGCATCATGCATATGAATGCAGTGCCCCGAGGGCGGTACCACGTACCGCAGGAAAACAGTAACCACCAAGCGGCCAAGAGAGGTCCAAG
GCGTGGGTCCGACGTTGTTGCGAAAACGCAACAACGTAACGGACAGCCAATAAAACGGTCAGGTTCATTAGGTGCGGAGCACCCTACTGATCCAGCAACG
TCAAGTGTGTTTGTAGGCCTCTTGACGAAAGTTGCTCTCAACACTCAGTCATTATGTGTTGTTGCTTCTAGTAATGAGGTTTCCCTCATTACCTTGAAAC
TCGAAGTGACACAAGGCATGTCGCTTCGAGCCCTAGTCGATTGTGGGGCGTCGAACAACTTTGTACGACGCCAATCGCTAGACAAAAGAGAGCTCGAATA
TGTTGAGCGAGAGATCCCTCCAACGAGGATGACGTGCGTCTCGCGACAGGCGCATCCGTAACAGTGATGAAACGTGTAGTGGGTATTACCTATACACTGA
AGGGAGTCCAATACAATGATGACTCCATCATACTAGACTTGAATGACAAATTTGATGTCACCTTGGACTGCCGTGGCTCAGAAGGTACGAGCCACAAGTC
AGCTGGCATCTACGAACAGTCGATAGCCTGTCACTTGTTCATCAGATGGCCATCTGATGAACGCCATGGATCGCCCACAAACATGTGGGTGTACTACGAG
CGAGTGCGATGGCCTCGCGTGTGGTTCGGTCGTTAGCACAACTGCACATGGCCATGGAGTGGCTGATCGCCACACCATGAAGCCAGATTCCCGCGACTGC
ATTGAGATGCAGGTCGTGCCGAAGGCCCACCACCCGAATAAGTCGAATGGACTGGGGCATGGGTGTCCTCCTAACGGTCGACACCCAAGTGACAACGAAC
CGATTGCCAATGATTGGCATGATGATGATCTTAGTGCGATTGGAGAATCGCACGTAGAAGACCTGGCCGCGGTAGCGCAACCACCGCCAGAAGATAACGA
GGGAGCAATTCCACTCGTGTCATGTGATGATTTAGCCCAAGAGGCTAGTGAGGGAATACGCCCCCACCCAACTGTGGTTCCCAGGAGATAACAGAGACAT
TAAATGTCCTGTTCGATGACGGATCAAGAATAGGCACTTACCAACTTGATCTGATCGCACCTCCGAAGACAACTTCGGAGATCACTCAATTGCCCACGCT
CGAACTGAATAGGTTCTTGCGTGATCTGCGTAGTGGAAAAGTCAAGCAGATTTGCGTACTCGTCGTGGAAGACGAGTACGTAACCGATATTCTGTCGGCA
ATGTTATTCGCTGAGAACGAAAGGGTTCTCAGCAGCTCATCAATGGACGAGAGTGTCGTTGATGAGAAGACTCGGATTAAGCGATATACATCCCAATCGT
GTGAATCGCTCAAGACAAATCCTCTCTACGATGATTTGACGGAATTCAGAGATGTGTTCCCAGAAACAGTGCCGTGCGAGCTACCCAAGGATAAGGGTAC
TCGTCACGAAATCGACCTGAAACCAGGTTCAAAGTACTGTCATGAAGCAGTGTCCACTGCCTCGTGAACAAGTACTAGCGATTGACAAATTCTTTGCCGA
TCGCTTGGCAGCGGGACATGGATGAGAATCACTTCCCCACATAGCTCTCCGACCTTCTGTGTCCGAAAGGCCACAGGAGGATGGCGGATAGTACATGCCT
TCAACAAGTTGAATGCTGCCACTGTACCGTCTCAAACGCCGGTACCAAGAAAGTATGTCATTATAGATGTAATGTCAAGGAGTAACATCTTTTCATCGAT
GGATCTGATGGACTGGTTTTATCAGATCCTTATGCGTGAAAAGGACATTCCTTATACAGCAGTGAGCACCCCAATCGGTATGCTTTGGGAGTGGTTAGTA
ATGCCCCTGCTACGTTCAACAGATGTGTAACGAATCTGTTGAGATCTGTGCGAGAATTCGCACCCAGCTATTTCGATGACGTGTTCGTCCATAGCCAGGC
TATGGATGGGCAGACGGATTTGGAAATCCACCGACTCCACGTCTAGAAAGTTCTTATACTGATGCGTGAGCATAAGTTGTATGCCAATCTCAAGAAGTGT
ATATTTTCTGCAAGCGAAATACCACTTCTTGGATGCATCGTGTGTAAGCACGGCGTCCGGCCCGATCCGGAAAAGATCAAGGCGATCACTGACTGGCCGG
TGCCTACCGACATAAAAGGACTTCGAAAGTTCCTTGGCCTAGCGGCGTATTTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCG
TTTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGTCAGCGCTCATTTGAAGGTATCAAGCAAAGCTTGATACGCTCTCCAGTTTTGGCGATT
GCAGACCAAGACAGACCATGTGGTCTGCGATGCAAGTGATTTTGCCATCGGATGTGCATTAATGTAGTACGACACAGACGATGCTGAGCGTGTCTTCTGC
TATCAGTCACGTCAGCTGCAACCAGCTGAACGTAACTACCCAGTCGATGACAAGGAACTCCTTGCCATGAAGTATGCTTTAGCAAAATTCAGGTTCTACC
TACTAGATGATAGACCCTTCATCGTATACACGGAGCACGCACGGCCGTTAACAGTCCACACCTCTCGCAACTAATGGCGAGGTGGATGTCGTTCTTCGCG
GAGTATAACTTCTTCGTGGAATATAAATCAGGACGACTGAATGTCGTTGCTGATGATCTGTCGCGCCGACCCGATTTAGAACCGGCTGTGCAACCCGAAA
CTGGTCCGACCACTGTCGCGGTGTTGACGTCGAGCGGCCCGTCGTCAACCATACTCGAAGCCATACGCAAGGCGTACGATCTGGCGATGGTGCGTTTGAT
GGATCATCTCTCGCAACCATCCTGTCAATCCCTTAAAAGGTTGCCCCCAGTAAATCGATCCTCCACGGATAGATATATAGTCCACAATGGTTTACTACAT
TGCCGGCGACACGCCTCGTGTCGTCGTACCGGACCATGGTGACATGCGACTGCGCATCATGTATGAGTACCACGATGCACCTACTGGTGGACATCGTGGT
CGAGAGAAGACATATCTCACAGTTAGTCGCGACTTTTACTGACCCCGCCAGTATCAGCTCGTGCGAAAGTACGTCCGCGCATGCGAAGTATGTCAACGAG
TGAAGTCAGGTCCTTCACTTCGCGCGCCGTTGCAACCCTTACCCATTCCGGCAGAATGCTGGGAATCAGTCTTAATGGACTTTGTCTTTGGATTCCCCGC
AGACCCACACAAAAATACAGGTATTCTTGTATTCGTTGATAGATTCAGTAAAATGGTACACCTGGTCGCTGTACCTGAAAATATCAATGCATCGGCATGT
GCTCGTGTTTTATTGACACGATCTTTCGTCTTCATGGGTTGCCTCGTGAACTCGTCTCTGATCGAGACCCACGATCCACTGCGGAATTCTGGCGATCCGT
GTTCAAAACACTCAGAACGCGCCTTCAGATGTCGACCTCTGACCATCCTGAAACAAATGGTCAGACAGAACGTGCAAAACACGTTCTTGAGGAAATCCTT
CGGGGATATGTCCATTCGTTTACAAATTGGAGCGAATCCTTGCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCGT
TCTTCGTGAAGGGCTTGCGCCACCCACGCCTACCCACCTTCTTAGAGTGTAACTCTAGTTTGAGGCGGGGAAGGAATCATTCTAGCGAACGCCAACTCGG
CTCTCACTCATCACGTACTGACCACGAGGTCACTGAGTAAGACGCCGATGTAGATCACATCGATTCGGTGAAGAAGAGGAAAGTAAGGATGAGGATGCTC
TTACTACCCAGGTCACTGATCTTGCCACAGTGCGCTCCAAGCGCACTACAGCCAAAGGCAGAGAGTCAGCAGATGAATTCATACTGGATCGCGAAACAGT
TGTCCATTTCGTACAAGATTCCATTGCAGAAGCATTGGACCGAAAAAAGAAAAACGCAGACAAGAATGGAATGGCAAATGTTCTTTCATTCAATGAAGGT
GACCTAGTCCTACTATCTACGGTAAACTTACCTCGACACATAGTGACTTACGTGGGTAGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTTGTTTGC
TGCGCCGCATAAGCAACGCATACACGATTGAACTGCTACGTAAGATGCGCACGCATCCTACGTTCTACGTCGGTCGTCTTAGACCTTATCATCAGTACGA
GACTTCTTCCGGTGA