Description :
From Genome Similarity Track
Location :
contig_179:17229- 18419
Transcript NameFunction/comments
g13970.t1hypothetical protein

Sequence
1190 bases(100 bases per row)
ACAACCAGCAACAAGTTCAGTCAACTTTGACCTTCTCCGCGACCTATTCCTTCGTAAATGCTCAAAAGGTTAGATTGTACGGATGCATCCGGATAGCATG
AGAAGTGAGCCGACTCAGGACAAAAAAAAACACAATGTATCGAGGAACAATCTTAAACCCCAGGAGTTATAGCAAAACCAGGACGTGACAAATAAACTAC
AGTGTACTTTTGCAATGCAAGCGCTGTACCCGGAATTCACAATACATGCACTCCTATTATTTTAATATCATCTTAAGCTACACGTATTGGTTAGCTTATT
GGTTTCCAAAGCTGAGAGGGTTGAGCCATCTTGAAGACAGTACATGTATAATAGTCACAATAATACATGTATTGTAGGTATATGTACACACATCTGCCAC
GTTGTAACCACATGCCAGCGTCTCTTTTGTGTGCCGGGCGCACAGCAAAAGTAGAGCGGGTGTCCTTGTATGCTTGCCTACTGTTTGTCTGCAATCCGTC
CTATCGTTAAGATGTGATTCGGAGACACGACGAGATGTGCTGCTTGATGCGGTACATGTACGGTACTGTAGTACCCCACGAATCGTCAATGCAATCATTG
ATAGCGTGCTCGAATTTTTAGAAAAGAGCAGTCTCTCACAGGACAGGTAAGATTAAAAATAATCTAAGATACTCTGAAATTAAACAATCACCAACTTCGG
CACAAGCCGCTATTTTTCACAACTACATGTACTCGAGTTGGCCTCATTGTCCAGTACATGTACATGTATGTTTGACCCACCTTCCTTTGAACTACGACGT
CACAGGTCACACAGATCACGGGAGTATATCGTATCGCATGCCTCTGGTCTAACAGCATGATAACTTTTAATGATCGGGTGCAAGCTGTCTCTTTGTGTCG
GACCCTCAAATGAGTCGCCTTGACGACCCGGAGGGATAGCCTAACCTACTCTTTTTCTCCGCTCCATTCCGCAATTCTTCCACCGAGACGCGAATCAACA
AGCTCCAGGTGTGGAGATGAAGACCCACGTCGTCCTCTGCGCCGCTTTGGCTGCCATTGCCGTCGTACAAGGCCAAGAAACGTCCAAGACGACTGTGAAG
TACATCGACTACTCGTCCTTGAAGAATTTAACGAGAGCTCCGACTGTGCAGCAAGACACGTCGGGGTCTCAGGACCAGCAGCAACAGCAA