Description :
From Genome Similarity Track
Location :
contig_73:172288- 173456
Transcript NameFunction/comments
g11738.t1RAW28077.1 hypothetical protein PC110_g15524 [Phytophthora cactorum

Sequence
1168 bases(100 bases per row)
AAGAGACTCTGCTCGACCGTTGCTGCTCACCGAGTCTTCAGTGACGAGGCGCTTGTTGATACTTTAGTCAACTAAATGACGGATATCCCTCCTGAATATT
CTCAATATCCTCGTTGACAAAAAATCGGTCTCCCACAGCATTTCCCGTCCAAACATTGGCAGCGGGAGCCCCGAGTTCAAAAGGCGTGGATTTTGGCGGC
GGCACCTTCATTCACGCACTCGCCTACAATGCGACGGCCTCGGCGCAATGTTGCAGGAGCTCGCACCTCCCGATCCGAGCTCACCATCCGTGAGTAACGC
GAGCCGCGTAAGCGCTGCTCATGCTTGTCAAAAAATGCCCCGCAAAAGACAAGCGACTACGACCAGCTAGTGCATGTAAGCATTACGCCGGCAGCGACAA
CGAGCCCAAGGTGAATGCCTGCCAATGTCTTGGGTCGGCCGTAATGCTGCCAGCATGGAGTCCATGGCAAGGCAAAGGCTGTTGGCGCGTCATCATGCGT
GCATGGAGCACAGTATCAACTGCCAGGTGGGCCCACCTCTCAGTTGTCATTTCTGATGTATCCATGTCGTCCACTTCAACTTTCTTCATACAAATACGAA
GTGTAAAGCGATCTAAACCGTATACCCCGTCGAATTCAGCGTGTCCACCCATGACGCCTTCCCGCAGCGGATCGCTAACGGATCCCACCGCAACGTTCGA
CGAACATGATATGACATCACTAGCGAATCCGCTTGCTGCCCAGTCAAAGTTTGACGCCCAGAGATCTCATGCTGGATTTGAGGTGGCTACAACGGTGCCA
CATTTCAATGCGCTCTATAGCGCGCACTCGGCCGGCAGGAAGCTTGCCAAGTGACTGGATCACGTATTTCCAACGACGGCGAGACAGAATGTTCAGCAGA
CAACGGAAATAGCGAACTCACACCTTCAAAGTTAGCGTCTCCAGCCGAGATAAGACTTCAGCCTGGACCAACACTTCAACTTGGCCACTAAATTTGGTCG
GCGTGGCCACGCCGCTGGGAATAGCTCGCTTGATCGGCATGAGATCCGGTTCGCCCAACGACGGTCATCACGATCAAAAGCCATCTGGCTCTGCAGTCAG
CAAGCCCCACCGTCTACGATGCAGGACATGGACTTGGATCTGCTCAACTTCGACGCCTTCTTCGGTCC