Description :
From Genome Similarity Track
Location :
contig_59:172283- 174473
Transcript NameFunction/comments
g10612.t1hypothetical protein

Sequence
2190 bases(100 bases per row)
CGGATGCCACGAGAAAGCCTCGTTGAACGCCGTCATGTTGGCCACGGGTGCTTCACGACGCATTCGAGTGTACATCTCGGGCGAGTCGTCCACGTGCACA
ACGTACTCGGCGCAATCCTGCAGACTGTCGAATCGGCCACAATCGATGAAGCTCTCGGGGTTAAACAACTCGGACACGGTCTTGGAATCGCCCCAGTACA
CGGGCACACTGCCCGCCAGAAAGGCATTCACCAGCTTCTCCGTCACGTAGCCCGCCGCGCGCGTGTTTTCAAAGGCGAGCACGAACTTGTACGGCGCATA
CCGGCGCACCGCGTCGTCATTGTAGAAAATGGCCAAACGGGATGCCATCTTCGTCTGGTCAGGAGGTCTCGACGACCCCGCACACTTTCCGAGGGCGTCT
ACAGGTCGAAGAGCATTCAGTGCGTCGTACATGAGCTCGCGGTCGCTTCGATCGCAGTGGGCGTACAAATATGCGCAGAACTTCGTCTTTGGAGACTCGG
TTTTCGTGTCCGAGGGAGACAAAAGCGACAACGGTCCGTGGTCTAGCCGCTCCGCGAAGGACGCACTTGCCATCGACAGGTGGATGTGCTTGGTCCGGTT
AGCGTTCGCTAGCGTCGAGATCAGCAGTACGCGTTCGTCGAGACCATCGGTGCTCCAGGCCTCACCTGACAGCATCACCAACTGCGTCGTTCTATCTGGT
TTTGTTGCACCAGATTTGTTGCGACTGCTGCTATCAACGCTTTTGGTGGTGCCGGCACTGTAGCGCTCGAAGTATTCTGCCACCATCTTCTGGCACGCGG
GTGCTCCTGCTGGATTGCATTTACCACCCAAGGGACTGAAGACAAACACGTCGGGAGAGATACCAAGGTATTTCTCCAGGAGGTTGGCTGGTATCACTAA
CATGGGACGCATTAGCGCCTCAAAAACGGAGGCGAAGAGGCATTCCAGCACAACGTGCGAGTATGACGCGCTAGGTGCATACGCAATGACCAGAGCGGGC
TTGGCCGGGTCTGCCTGGAAAAGATTATGCCGCCACAGCTCTCCTCGCGATAGGTCGATGGGTCTTTCTTGCTTGAGTTGGTGGTAGCAGTCTTGGATTT
TCGGCTGTACAGTTGTTGCGAAGTCGAAATAGCTGGCGTTTGCGACTGTGAACGGCAGGTGCTGCTTTGCCTCGAGAAAGAGAGACAAAAGGTAGGACGG
GAAGGTGTTTACTGATGAGATATATGAAATCTCGACCCCTGCATTGGTTGGAGCTGACAGCGTTGTCGTCACTTGCAAGTGTCCTGACGAGACGATTCTT
GTGTGGACATCAACCTGCAGTTGGTGCAATTCGTGGCTTGGGATAGGAATTGCGGAGATCATTTCCAGTTGAGAGGGGGACTTATAGTGATTCCACGTGA
GGCGGTCGAAGTCATGGCAAAACGCTTTGCCTCCAAGAAGGTTCGCATGGGTGATACGGACACCGAGTGGGGATAACTCTGCAAATGAGATTAAATTGTC
TCTGCAGGGCTGGAGAGTAAGATGTGAAAACTGTTGTGTGTTTTCCAGATGAACTTGCATCACTAGTAGCCACAGCCCGACGCTGACATCCTCCAGTCCA
TTCAAACTCCGCAGTCGCCAATGATTTCTTGAAAGAAAGCGAGCACAATCCATCGAAATCACGTAGTGAGGACCAAATGCATAGGGCAGAAGCTTGTTCA
TCGGATACTGATGCTTTGGCAAATAGTTCTGGTGCGATTCTTGACGAACAGGGGAAGAAATGCGAGTAAAGCTCGAGCCCCCACGCTTGACCCATATACA
TCCGTTTCCTTCTCCCTTTTTGCTGAAGGAGTTGAATTAATTTATCCACTCGCAAGTAGATATCATCATCTGCGATCATCACGTACGGCGTTTGTGCGAA
TTCGGCCGCCGCAAGGTGGAAAAAAGCCACCACCTTCTCCGCCAAGAGTCCGTAGGAGTCTTCACACTCAAGCTCATCGGTCAGCAGGTCTCCGTACACT
TTCTTCTCCATATTGACTGCATCCTGCAAGTATCGCTGCTCACTCTCGTCGTGTACACCGAGCATGTTTGGGTTACAGCCCAGAAACATCACTTTCGCTC
CATATTTCCTCGCGTCCTGTGCCCATGTATCTCGAATCGCTTGGCGACGAGCGAAGTTTGTCACCACGGCCGTCTTTATTCCAATCACCA