Description :
From Genome Similarity Track
Location :
Scaffold_29:172259- 173378
Transcript NameFunction/comments
Sapdi_VS20SDRG_09133TKL/DRK protein kinase

Sequence
1119 bases(100 bases per row)
TCGGGTGGCGGAGACCCGCGAGGAGCTCAACGTGCGCCTTGAACTCGACAATGGTCTCGCGCGTCAAGACGCTCAGCCTACGACCATACGATGTGAGTTG
CAACACTTTGGTGATGGCGTCTACCGCTTGATGGCGACGCGGAGACCCGTGTACTCGCCGCGCACAACATCGCCTTTCACGTGCTCGCTCACGAGCTCGT
GGAGCGTGAGCTCTTCAAACGGGATCGACACGTTGTGCAAAAACTCGTTCTCGGGCGACTTGGCGTGCAGCAGCTAATGCATCAAACATCCTTGGTACCG
TCGTCCTCGAACGCACGAGGGACGTACTTCTTGGAGCAGCTGCTGTTCAATGGGGCCGACGCGGCCGCGGGTCGCGAGCTGCTGGCGGTTGACCGTGACA
CCGTGTTTGAGCGCCGTATTGACGCGTTCGGCGTCCATCTTGGAGTAAAACGTGTAGCGCGCGGCGCGGTCGAGGAGGTAAAACGCCACCAGCGTGAGCA
CAATCGGGAGGCAAATCGCAAAGACGAACGCGACAAAGTTCATCGACATGAAGATCTCGTACGAGCCGGCGTTGATTTTCCAGTTGATGACGTACACAAG
CGCGGCCGAGAGCAGGACGAGAATGACCTACCCCTCGTCGTCATCAGCCACACTTGACTCGATCGTACCTGGGGAAAATCGAGCTTGAGGCTCAGGCTGA
ACAGAATCGTGTCGGCGACCGCGTTGCACGCAAAGATGATCGAGATGTACTCGTTGAGCATGTCAATGTACTCGAGGCGCCACGCGGCCAGGGTCGTGGA
CCCGTTGTTGTCGACCCAGTACGCGGGCGCGGGTACGTTCCTGCCACACGTTTGATGTTGGCTCCACGCGTTGCGCTCGGTTTGGGATCGCTGGAAGACT
GTGCCAAGGTAGATGAGCTTGCCCGTGCAATAGAGCGTCACGACGAGCGTCATGCAGTGCTTCCAATAACGACGGGCCCAGTACATGAGCAGCTTGCTCT
TGCCCCACGAATTGAGGAGGCGGAACGGGATGAGCGCAAGGCCGAGAGCGAACGGAAAGTACATGAAATGCACGACAAGCAGATCCTCGCTCGCGAGGTA
CTCGAGGCCATGGAGGCCC