Description :
From Genome Similarity Track
Location :
Scaffold_602:17225- 18241
Transcript NameFunction/comments
Phyag_g6947hypothetical protein

Sequence
1016 bases(100 bases per row)
AATCTCTGGGGATGTCGATTGTCCAGGGAGCCTTCAACAACAGTTCTGGAATGTGGACTAGAGCTGGTGATGGAACCGTTACCATCACATTGAAGAGTAC
TGATACGGAGGATGTGACTGTCAATATCAAGTCTGGTGgcgacaagatcgacgaggtgGATGTTCCAGCAGGAAAAACTGTGAGTTGGAGGTCAAACGTG
ACAGCGCTGGGAGGCAAGACGCTGTATTTGGATCGGTGGCGTCCAGGATTCTTAGGTCTTCCTGGTACTGGTGGCGGATCATTATTGTTATGGGTCCCTC
GCTTCACTCAGGGCGGCAACTTGCACCTTACTGCGGTGCTCAACGTAGGTTGAGTGAGTTTGAATAGTAGTTAGTAAAATTAAACAGCTCATGAAATAAA
TTATAAAGCTTGCTTGAAGCTGTACATGATCATAATAATATGGCTGAACGCTGTGATACATTTATTAGTTCTGGTCGTCTTGCCTTAGCTTGAACGACAC
TTTTGCTCTCGATCTGCATACACTTCATCATACAGAAACCATGGAAAGAGCACTTAAAAAATCTGTATTTATGATTCGCATCACCGAGAGTGCGACACAA
GCCGTGAAATTGAGGTGTTTGTTGAACAGAAGAGCTGCATTTAGTTAGTCTTGCCACTCTCAAAGATTAAGGCAGCTGTGATCAGTGAAGTACGAAGAGC
ATAGTGCCGTTCAAGATGACTGAATGCAATGTGTACTCGTAATTTATGCCGAAAAATAAATTAATGCGGATTGCAATAGATACGATCCAATAATTCATTT
TGCAACATTTAACATAATGTACCAATAATTCTTAGATGTTATAGTGCTTTTCTGGCTTTTAATTCCGGCGTAATTAGATCCATAAAAAGGCAGCTACCCT
TATTTAGAGCTAATTCTACGTACGATTGTGACCGCTTCCGCTAACGCACGCGATCAGCTCATCGGTGGAGATAGGAGCGGGTAGAGCAGCGATTTGGAAA
AATATATTGGAGATAC