Description :
From Genome Similarity Track
Location :
Scaffold_692:17224- 20317
Transcript NameFunction/comments
Phypl_g10354hypothetical protein PHYSODRAFT_487308
Phypl_g10355conserved hypothetical protein

Sequence
3093 bases(100 bases per row)
TACTGCGGAGTCGCATTCGTTGTGAGATACTCCCGTCCGCCAGCGAGCACCATCAGAGCTTCCTCTGCGTTTTGCACCTCAAGGACCACAATCTGGCGAG
CAGCGGAGGCATTTGTTtcagctggtggcgctgacATGGCTTCGATGCCCAGCAAGTCGTACACGGTCTCGTTGAAGACGGCAAGGAAGCTGATCGTAAA
CTTGGCTCGGTGGAATCGAGCATCGCTGCCGTGTGCGCCTACAGCTGCAAACAACTCGCGGAGTAGCAACTCCGGAACTGTTTGTTGCGCGGCAGAGCCC
CCGATGCGCAGCGGCGAGGCACCGACAAATGTGGTGACGCATGCGTTGCATCCGTCGAGGACAGACTGAAGAAGTGGCGTTACAGATTCGTGGCGGTCCC
ATTCACGTGCTCGGTCCGAGAAAACCGCATCACACTTGACACCCAGCACTTCATTACTGTCGTCAGAATTGACATCGCCTTCACGCAGGAAcaactcgcc
gctgctgtagtTGGCACGCAGCACTAACTTGTCCGACTTGTTTTCATCCCCAACTACACTGTCTGGTGGCGGCTCGACATTCTGTAGCTGGCAAATGATC
GATGCGTCTTGTCTTGCCCGCCAGAGTTGTTCGTGAAGGTGTCGGCGTGCTAATTCAGCTCTGTATAGTGCCAAACGCAGCGGGGCATGCTCGACATGCG
CTGCCTTTGCATACCGAGATGAACGTTCGACGAGAGTCATGACGGGAGCACGTAGTTTCTCTAGGAATCGTCGGAAATCCCCTTGAATAGCTACAAGTGG
TGCTCGCGTCTGTGCCAGAGTTGCTCGCATTCCACGCAAGGACGTGACGGCATTGCGAGCTAGCCCATTCACCTGACGACGGTACACAGCGTGACGCTGA
ATGGCTGCTTGCTGAGACTGCAAGTGCTCTCGAGCACTAGCTCCGTAGGCCTGGAATGCCTTGGACTCGGCAGTTTTGGCGGCTACAGCCCCCTTGAGCT
GGTTGGCTTGATGCTGAAGAGAATCTCGCTCGTCTCGTACTGTTTCCAGTTCGCGCTCTCGGAGCTCAGCACGCTGACGAGCAGCCTGCAGTTGTTCGCG
AAGAGCCACGTTCTCCCGTTCTCGGTGCTCACTTTGCGCCTGCGCCTCGGTCCATTTCTCCATGATTGCCTTGAAGTGCATGCCGCGCTTACCCATTTCT
GCGGTCAGGTGCTCTACGTTGTCGCGCAGCAATTTCGTCTCCTGCGTTAGCAGTAGACGCTCTTGACGAAGCTCTTTTGCGGCTGCCTCACTTttctcga
gcgcttcgcggTCTTCTCTGGCGCGTGtgcgcagcgctgccagTTCATCGTGCTGCATTGAGATGCAAGCGTTCAGTTCCATCACCTGCATGGCGCGTTG
ATGAGCTTCCGCAAGtgccttctccttggccttcttggcatCCAGCAGTTCTTTCCAGCAGAACTCACCGGCCTCCGCGTCATTAAGCACGGCAGGGGCT
AGTTGATTCCTCGCAGAGCTATTTGAAGCTGTCGCATCTCCTTGTGACGCTGCACGCTCGGAGCTCACTTTCCGCTCAccctccgcagcagctcgcaaTG
CCAACACCACTTTCTGCAATtggtccagctccatcaacAACGAGTGGTTGCGCTTTTCCACTTCCCCACGTTTgccgcgctcttcttgcACCTTTTCCGT
CATGTTCACGAGCAGGAAGGCCAACGACTCCGGCTCAGATGCATGACTCTCTTCGGCTTCATCctcatcttctccttcagtTTCGCTGCTTGGTTCCTGC
TGGTCACCCCCTTCCGGTGCTGTACGAGGGTACTCATCGTCATCATGAGCTGCAGTTAGTCGGTTCATCTTTTCCGCTTCACTCGTCGGACTTTGTGATG
ACTTCGGCTATTACTTTGACAACCAGAGCTGCAAATGCCATACACGGTCGTCAGCGCGCAGGAATGAAGCTCGTGATACAGACACAGCAAGAGCGAAGTA
GGTAAGTGATGTGGTTTCTTGCTATGGAGAACACCGCGGCATGGGAGCATGGCGGAGGCAATGCTCCTCGCACTCACTCAACTTTTTATAGgcgagttga
agttgccaAGTATAGATTAGCCAGAGGACAGGTCTCGTCGTGTTCTCTCACATCCAGTGCAGTGATTTCCATCTTCCCGACGCTGTAATATGCAGAGCTC
ACGATCTGCTGAGCGACAGCTTCCGTTGGGCGTGAAGGGCCGACTCAGTAAccaggagatggagcagctccgcagTCAGGTGAGTTCCGTGCACCTCGAA
ATGGCTAAAGCTTTGGTTGACGCTTTCAATAGCtcgcacgcgcagcagcgtacgCCCATGTACCCGAGCATCAACGCGCGGCCCGAGCTGCAAAAGGCCA
GTCGGCCTCAAAGCCAATGACGAAGGTCTACCGTCGCGTAGAATCGCCCCGAGATGCCAGTGGCAACCAAGCACGACCAGCTCGGAAGACGCTGGCAAGC
ATCCAGTATGAGCACCAGTTTTCCGCAAAGGCGTATGACTCGCTGAAGCCGCGCTCCACTCGTGGCATCAGCACGGAAGCTAGGACAATTCTACAAGACG
AGTATGTTACCAAACCGCGGGAGGTGAGCTGCATCCCTCAAAACCTCTCGACCGCAAAGCCAAGCGATGGCCCTGAAGCCGATAACCAGACCTCAAGTGG
CAAACGTCGCGGGCCTGCAACCATTCCTCAAGTGTTTATCATGTAGCATTGCAGCCAaggaccccccccccccctttcGTTGCACTTCAAGCAACCATTA
GTTAAGTACACTGTCGGATTTGTTTCGATTGCGCTCATTTCAGCTTGAGGACGTCGCACAAACGCAAAGAGCACACACTCTACGACGGCACGTAGCGCCA
ACGCGCGCGAGCGTCCAAGTCGTCTTTCTGGGCAtgttgacgcagcagctcctttTTCTCGCGTTGTCGATCCTTCTTGCGGCGGTTCTCGCGCTGACGC
TTGGTAAGTCCATCCACCAACGGCTCTGCGGGAGCGGCATCTTGCATGCGACGCACCTGGCGCTTGGCAGCACTCGAGGTGCCAACCACTTGc