Description :
From Genome Similarity Track
Location :
Scaffold_289:1722- 7439
Sequence
5717 bases(100 bases per row)
AAAGCTCGTCAATTAAGCAGCATGATGGCCCTAAGGGCAAGTTCCAGTATATCTGCTGCCCGTCTTACACGAAAGCTTTGCTATGTGTTTGCAAAGTTTA
AGGCCAGAGGCCAGTTGCGATCGTCGTTCCGATTGTGCTATGCACCTCCTCAGTTTTCATCCCTCTGGTGCCTCGGCTACTAACGTAGCCATGAGTCCAC
AACATACTGCGGCTATGGACCCAACCACCCTCACCAATACTGGTTGGAAGCGACATGGGTCGCAAGTTGAGCCCGACCACAATGCTTAAAACCATCCACA
GCGTATAGGCAATCTTGTTGAAGGGGTTCCTCGTATTCCCAGGGGTTTTCAGACTCGGGTACCCATGCCACTTTGCTAGATACTGGATTCGGTATTGGCT
GTGACGACGACGACGATGACGCTGGAGGATTTCTACAGATGAAACTACAATTCCCATGCCGGTCAAGCAACGCTGGTGGGATAGGTGAATAGGCAAAAGC
CCACTCGGAGTTGCTCCATGAAGTGAAGTGCCTTCATAAGAGTTTGTATCAAATTCAGAGATCAATTGAGGCGGTACAGACACTACAAAAGCCAACGGAG
AATAAGAAACCCCGAATGGATGCGCAGCTGGATCTCCTAGTGCGTATATTACAGCCCGCGACGAGGCTGCCGTCCCAGCGCGGGAGCCTCCGCCTATACA
TGTGTCGGGTCACAATACGACTTAAGCATTTCAACGCAATACACAGGGTGTGTACGCAGTTTTCGAGGTAATTTTAGCGTATACGCTAAGCATTTCTTGG
CAATGACCGTAAAGGGTCCGATGAAGCGTGGATGAAGCTTTTCTTATAGACAGAGGACATTACGTTTGTAGGTAAAGGTTTGGCGCTGAGTAGACCTCGT
CTCCAACATCATATTGGTCAATTCACCCTCCTCCTTAGGACCCGCTCGTTCATTCTGTATATTTTTTGCTTTCAGCCATTGCGTCAATCACATGTCTTAA
AAAACTTAAGCACGTAGTCAGGATCGCGCTCACCTGCTTCTAAATGGAATTTGAGTTTGCATCAGCAATACAATCAGCAAGCCCCCTCACCAAGCCCAAA
ACAACGGAGTGGGAGTGCTAATGGTGAGCGCGGGTACGCGAGGCCGTTGACGTGAAATAGAGTAAAGCCCGCAGAGGCGTGTACGGAGTTGTTAAGAGCA
AAACTAACAATATGAAGCATAGAGCTCCAACGTTTAGTCGCAACTACACATATACTACGTAGGATACGTTCGACAGCGAGATTAACGCCCCCTGTTTGAC
CATTGTCCTGTGGATTATCGGACGCGGACATATCCAAAGGAGTTCCAAGAACCTGTAAGGAAGAATATCAAACTTACTCGTGAAACAAGGTTCATGGCCA
GAGCCGATGGCCACAGAAAAACCACGAGAGAGACATTCCCGATCGATAAAAAAATGTGCTTTAACTTCACCATTGATTGAGTTTGGCACATCCGCTAAGT
TAGCCATCTTTCTCAAGCGGTCAACAAAGACCACAATACCAGTGTTGCCATCCGAATCTTTCTGAAGGCCAAACAAAAACTCCATGCAGATAGATTCCTA
ACACCCCTTCGGTACAGGGAGTCTCGCCAGTGGTGCAGTTGCATGTGCGGAGGGTTTAATCCGTTGACACGTTCTGACATGCGCACATAGGTACTAACCC
ACTTATAGATCTTGGGCCACTAATTACTTCGACTCACCAAGTAATAGTTTTTTTTACGACTAAGATGACCGTTCACCGTTCACCGTAGTGTCACGTGCAT
CATAAACGATTAGATACTTTTATGTCTCCTTAGGTACTGAGGACACCCCCGTATAGTCGTATTGTACCTGCGATATCTCAATAGAACTTGACCGATACTA
TATCGGTGGATCCGCTCACTCAATCGTTGACACCTAAAGTTTAAGTATCGAAGCTTCTCGCTCGCAAGTGCACATAGCAAAGATATATTAGGATCATCAC
AGGCGTAAGGCGCACGAATAAAGTCGGAATGGACGACCACAATGTTGTCGCATGAGCAATTATAAGCAAGTTCGCGTGACAACGCATCCGACAAAGCGTC
CAGTTTCCCGGTTTGCATTTAACCTCGAAGTTTTATCCCGCAAAGAATGACAACCAACGAGTCATTCTATGTTAAAAGTGCGGTGACTGGGTGGCGGAAA
GTGATGACGCATGATCGGTGAATGTCACAAACGGCTTAGGGCCAAACAGAAGTTCTCTGATTTCAACTATGGCATACTTCATGGCAATTAACTCATTGTA
ACTAACTGGATAGTTCTTTTCAGAAGCTATTAGCTGGAAAGACTCAATATCAAGACACGCCCACGTCCCTCAGAATCGGTTTGTAACAGAGCACTGCCGA
TTGCAAAACCAGACGACGCTGAAAAGTTTTTTTGGATCATGCAGGGCCAAAATCGGGGCATGAAGAAGACTCTACTTTACAGCAATAAAAGTATCCTCTC
CAATGCGACTCCAGAATCAATCCATATCATTTTATCTGTTTTTTATTGGACGATGGACTTGTCATATAAGGGTAATTCGCCCTATACTTTTGCAATTATT
ATACAAGACCGAGCTACTTGCGCAAGTCCTTCTATTACTATGAACCAGCCAATCAACTTTGGCCTTAACTTTTACAGGGTCTGCTCTCAGCCCACTCTTC
CCTATGAATCACCCCAGAAAGGTAATCTCTTCAGTACTAAAAATACACTTAAAAGCATTAGAATACAATATATTGGTGCGCATGCACTCGAGCACTGCTC
GAAAATGTTTGATGTGCGTTTTCACGTTGGTACTCCGTGTCCTGATCGACTATTACCAAAGATATCATCAAAAAAGTAAGTCTCTGCATAACCTTGGTGA
GGACAAAACAATTGCGTTACAAGACGATTTAACGTAACCGGGGCATTAGATAACCCGTGTGGCTTCACCGGCCATTCCCGAAGCATTCCACTCGGATTAC
TAACTGCTGTGCGCGGAATATCGCTCTCCCGTATGAGCAATTGGTATTAACCATCTCTAGGTCGAGTGCTCTGCACATGGTGCAACCAACCATGTTGTTT
TAAAGAATATTGTTCCTAGGAATTGGCGTTTGCGCTTGGATAACAGCAGTATAGAGCTTATTATAAGCATGAACAATGCATCCCTTGCCATAAGGTTTCT
TCACACAGAAGTTAGGTGTATAGTGTGGAGATTTACTCTTGCGCACCATACATGCCGCGTTCTTTGTACGAAATAACTCATCGATCACTCGCACTGTTAG
TTAGGCAAAGTCCGTTGCCGCGTAGCGCAATATTTGTTCCCGGAACCATATAAATTTCATGATGTACACCTCTATCGAGAAGTAAGAACGGAGGGTCGTG
ACACACCAGATCTTGGGATTCCTTAACCAGAGGTTAGTGAAGATTGAAATAATTCTTAAAAATAGACGATCCACTACGAAAATATAGTGTCTCTTTTGTG
TCGTCAAGGATAGCCATATTTATTACAGATGATAAGTTCAGTTCCAATTCAAGTCTAATGAACACCATATCCGATAGATTACCAGCCCTTTATTTCTGGT
AAAATTCGTCCACATACATTTTATCCAAGTCGAATAGAGCATGTATGGATGGGGGGTCGACATGCTAGCTTTACCATTAACATCACCTGTCACTTCGTTG
ACTAAGGTATGTAGCTGTTCACCATCTTTATCGTGTGATAAACAGACGATTTGTGTCTTTGCGCAGCTATCTGGCGTTACTGACGTCTCTACAAAGAAAA
CAAACACCTCAGTGGGGTTGTAACACAGGGTCACAAGGTTTTTATACTCCACAGCCTTAATTTTCTCTATACTAGATCCGATGTCGTTACCGAAATGTGA
TAAAAAGCTACCTAACTCGAACTCATCACCACGTGGAACACGTGCCACTGTACGCAAATCAGTTGCGCATACTTCTTGTGGCCTTAGCCTTTCGTCAAAA
ATCTCATTACTGACGTTTAGTGGATTTATATTGCAGTAGCCATCACTCTGTGGATTTTTACGTGTCACTCCACGTGCATCCGTAGTGCATGGATTTTGAT
GCCTTGTCCCTTTACCAACAATGCTATCAGCGTTCAATGACTCGGTATCACTACGAGTATCACTCAACGGAGTACGTGCCGTTCCACTATCGATCACGGA
GCTCTGCTGGACGAACGTCATCAACCTCGGAAATTACTAGCTATGACATACCGATGTCTAGCACACTGACCTACTCAGCCAATGGCTCGCTCCAATAGCG
CTTTTGTTTCTAGAGGAAGTAATTTCATGACTCTCCAAAGCTTCGCTAGGACATTGCGCGTGCCGCCTATAGTTTTGGACTTCCAGTTAATCCAGTGCTC
ATGGCGTTCAAGCCAAGCCATACCAAGAATGAGATCATATCTCGAGTCTAAATACAAGACAAGATAACGTTCGATGCTCTCGAAATATATAAATTTCACT
CAATAGTTCAACGAAACTTTAGGGGTGGTGTATCGTGCTCCTGTCTCAATACGGACAGTGATGAAATCACCTTCTTGCGCTTCGAGCGACTCAGCATTTT
ATTGATTTTCTTCAAGTAGGACATAATACCGACGCACCCGTGTCAATTAAATTGACCATGGCCTCTCAAATCCCTTCACTGTTGCTAACACAAGTAGCAA
GCCTGGCTTGTATCCACGCTCCGTGGTAACCCCTACGGAGTTCATTGCGGCTAGATTTTGTTTCTCATTACCTCCTAGAGATTTTTGATAACCTAGTTAT
TCCCCTGTTTGACGCTGCGCGTCTACTGGGAGTCGACATTTTTCCGCACCAGGGCTCAAGCCTATTGAAGGTATCCTTCTGATGCCCATAGGTAACGTAG
CGAGATGACGTTAATTCAGTTCTCAAAGCAATATTAAATGCCTCCTCAAAGGTCGACGGGTGGAACCGAAAGACTCCCGTCCTAGCAACCCCGGTGCGGT
GTCCTTCCATAAAGATGGTTACGAGGACTTCTTGTGGAAGGTGATCCAGTTGCATGGCTGCACTACGAGTTTGCAGCTTCTAAACATCGTCTGATAACTA
TTCCGACCCCGAGGAGCAGCTAAAAAGCGTGATCGCACGCGATATGCCTGACTAGGTAGTGCAAACACTCGAGACATTTGTCTCTTTAGCGAATCCCACT
GTGGAAACGCGGCGTCTACATACATATTACACGATAGTTCCCATTCTCTAGCTCTGACGACTAGTTTGGAAATGGCCATGTCAACTTGTTGTTGCTCAGA
ATCGAGCATAGCGGCACTCATTGCCATTTCTACAAACCGGATCCAGAGGAGGAGGTTCTCCCTCTACCCGTCCAAAGTCTCAACCTTTAGAACGAGTGGT
CTACCCTTAGGATCATTTTCTGCTATACATGCATAGCTAGTTGGCACGTGGTCATGATCCTGACCGATTAACGTGGCTTTAAAATTTAAAAAGACGTCCA
GACATGCGTTAACACATTTGGTACCTGCGCCACAACGAGGCTCACTTGTTCAGCGCCTATCAAAGCTAAAAGCTGATCCAGAGCCAGTCGTTGAGCCTCA
GGGAGGTGGAAAATTTCTCCATCTCAAAGGTGATCAGTCTTAAAGACTCAGTTGTGGGATTGCCTACAACGGCTACCAAGTGTAACAGAGCTCCACCACT
TTTAGTCGTAGAGAACT