Description :
From Genome Similarity Track
Location :
Scaffold_147:172189- 176091
Sequence
3902 bases(100 bases per row)
CTTCGTCTGACGCTAAAGCTACGGCAGCCCCGATGCACTTGGTAGCACTTGTAGTCCATCCCGCTCCTGCGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCGTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCGTCGCA
AGGTCCAGAGGTGGTCACCGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCACGTTCAAGAGAAGATGAGCGCCGCAGTGGCGGCG
GCGTCGATGACACGTGATGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAAACTTCGAGGGAAAGGTTGGAGAGAATGGACCCGTGAGGACGA
GGTGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCCCCAGACTTGGAGGTCGCGCTCGCGAATGGGCACTAACGTGC
GGCACGTCTGTTGACGCTGCATTTCCCAATTGGGATCAGCTAAATCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGTATTCGGTCGA
AGCTCCTTGCTACCCGCCAGGGTAAGAAAGAGTTATTAAAAATGTCCAAGAGTTGAGAAATCTTATCGCCGGAATGGCGGCGGACCCTCTTCTGGAACTG
GTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGCTCCATGTACACCCTAACTCTTTCGAAGAGGTGGTGGATGTGG
CATTGAATGCCGAGCACAACTTCAGGTTGGCTCGACCTGGGTGGAGCGCTAGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCAATGGACCTCTGCTATGC
TAAAGACGAAGAAGCGGAACTTCTCGCTGCGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTTAGTATTTGAAGGCTTATTGCCCT
CTGCGCAAAAGGCTCTAGGCTCCGGCGAGCCAACCCTATGGTTATATCGCCGGGAAACGGCAACTCCTAGTAGGCGCGAGGCGGCCTACTGAGAACTGAG
TTATGTTGTGCTTCGAGGAGGTAGAGGGCAACTGGGCTCAACCCCGAAGAGAGCTGGGCTCTCTTACGAGAAGCGTGTGTGCAAGCCGGGCTTGCTGGTC
GTTCAAGCGAGCGTGAAAGGCTTTGCAAAGTCATGGAGAGTCTTGATCGACTCGGGAGCCTCGGGCAACTACGCTCGTCGCTCCACCCTGGAAGGGAGTC
AGCTGTATGCTGAGGCACTGGAAGTGCCAGCGAGAGATATGATCACTGTCCGTCTCGCGACGGGGATACTGGTAATTGTGTCGAAGGTCTCTGTCGATCT
TGGAGTGAAGCTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGAAACGC
CATGAGCCATGGATCGACTGTAAGTCAAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGC
AGAAGCGCTTTTGGTGCGAGCACGGGGCCGATGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAAGTGCTAGCAACGAGGTTGCTGTTTGCCCTGAGGG
CGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAACGCGGGAGTGGCGCGTAATCC
ACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGGCCCGAGGGTCGCGGTCGAGCTGCGAGTCGAGGCATCGTGGGCGCGGCCCAGGAGATGC
AGGTGAAGTGACACCTTGTTCACTGTGTGAAGGTCAAGGGCCTCTTGGCTCTCAACCGAGTGTCTTGCGAGACACTGTATCCTCTTTCGAGGAGTGATGA
TGCTGCTGCACCCGGTGTTGGTGATGAAGATGTCGCCACACCGCCCTCATCCACCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGGGCGTCT
GTGACGTCTTCGACGTCGGACGAGGTGTCCAACGTGATGAGCGGTGAGGCTCCACGTGAATTGCTGTGAACAGCTGCACACACTCGTCAATGAGTGACCG
GGGAGGTCGAAGGCGACATCAGCCTTGACACTCTACCCGCTGTAGATACTCCTGCTTGATCTGGACGGATGTTCATCGCCGAGTTTGGCGAAGCCTTGAA
GGCAGGCGAGCTAGCCGATGTGGTCCTGCTGGGACCCGAGGAGGAGTTGAACTCCTCATCCGTCGTGACGACGCGGTCCTAGAGGACACCAAGAAGGCGC
TGAGCGCAAGAGAGGATCGGCAATCCTAAAAGATCCTTCGGATCCCTTCTACTCAGTGGTGAAGAAGTATGGAGACGTTGTCTCGAAAGACCCACCGACG
GGCCTGCCTCAGGCGTGTGTCACGAGATTGACCTCGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTACCGAGAGAGCAGTGTGACGTCAT
TGACGCATTCTTTCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTACGCAATCGACACCCATGTTCTGTGTCAGAAAGCCGAACGGCAAG
TGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCATCGCAAGGATGTTCTGCAGAACAACATGGTAGACT
GTACGCTGTACAGCGCACTCGACTTGATCGATGGTTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGATAGCGGAGCGTACTCCGAGCGGTAT
GCTTTGGGAGTAGCTGGTCGTGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGGCGCAGTTGTTTAGGCCCCACCGGGCGTACGCT
CAGACGTACTTTGACGATATATTTGTCCATAGTCGTGCTGAGCACGGAAAGTCAGACGTGGAGAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCA
TGCGCACTAATAAGCTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAAATACATTTCCTCGGGTGCTTTATTGGGAAGCGTGGCTTACGGGC
AGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCTGGTTTCCAAGGACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAATTAC
AGCGCGCACTACGCGGAGATGGCTAGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGCAGCCTTTGAGACTG
TGACGGAGATCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCAGATCGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGC
TTTACGACAAGCAGACGCCGAAGGGCGTGAACGCGTGATTGCGTTTGCGTCTCGCCAGCTCAAAGCTGCAGAGAAGAGCTATGCAGTTCATGACAAAGAG
CTACTTGCAATGAAGTATCTTCTAGTCAAATTCAGGGTACGCCTGCTAGGCTCTAAACCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGA
CACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGCCGGCTTAATGTAGT
GGCCAATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAATGACGTCGTCAGTGCCTGACTTGATACGCCGAGCGTATGCACAGGAC
GA