Description :
From Genome Similarity Track
Location :
Scaffold_51:17217- 19888
Transcript NameFunction/comments
Hyaar_Emoy2806471hypothetical protein

Sequence
2671 bases(100 bases per row)
CTGTTCTGTTTCTGCCTCTGGCTGTGGCCGTGGCCGTGGCTGTTGTGCTCCACAAGAACAGTAGAGAGCCACTGCTTTGATGTCACCATCTTTTTGGTTA
CCCACCCGCCTTGTATGCTTGATAGTGAAAACAAAGCCCTCATCTTGCAGTTGGGAGTCTACTGCTGCACGAGCCTCGTCTAGGGTGGAAAACACACGCT
CTTCAAGCTCTCCAAGTAGTTCCAAGTTGTTCAGGTTGTTCATTGCAACGAGATTAAGGTGTTATGGAAAGTGAATTGACGCTGAAAATTGGCGGCAGCA
AATTATTTTTTCGTGATAATATTGAATGGTTCCAGCCAACCACAAGCCTCGAAAACGAGCCTAGGGGTTCTATCGACAGGGAGGGTGGTGGTTAGCCAAA
GGTGAGTGCTGGTTAGCGGCTCCCTATTTTAATATTAAAAGGATTAAGTGGATGTCTTGGCATTAATTTAATTTTTAGGACGTAAAAAATACAAAACGTT
TTGTCAAATAATACTTTATTTTAGAATGAAAATTCCGTTAAGAAAACATTTGTTTGTAAATTTTTTAAGGACAATGAATCGAAATATTTAAGTAACTGCT
AAAAAATCAAACGAGATTCCGTTAGTTATAATGAATGAAAATGGAAATTAGGTTTTTGATAATAAGAAATAATTTTTTAATTTTTTAAAATAAATTCTTA
AAGGTGAAAGTATTGTAGAATAATTCCTATTTTGATAATAGTAAAAAGAGGTAAGCGTAATCTTTTTTTATATTGGGGAGCCACCCTCAAAATCTTTTAA
TAATTAATGAATTAAATATAGGTATTTTATATTTATTGGCAATTTCCTCAATAGGAGTATATGGAATTTATTCAAAGATGAGATAGAGTAACAAGTTAAC
TTATCAGGCTCATTATCTGAAGATGTAGGTTCAAATCCTACTCTCATCATAGTTTCTTAAAATGTAAGAATAATTTATGATTCAAATTCAAACTTAATTA
AGAATAAACGATAATAGTGGTATTAAAATAGGACAATATAAATAAAAAAAGTTTATTTAAAAAAAGCTGGAAAATTGGAGATACTGATGTCGTTAAATTT
GTCTTTACCTTGCAGTTAGTACACTGCCGCTCTTCTTAAGTGATGTAACGCTTGAGCAGCATATTCATTTGGCTTTTTATTTTCTTCGCAAGATACACCG
TGATAAACCTCGAAAACGCGTCTATAATAACTAGTACTGCATAAAATATCATGCAGTTGTAGTTTTTGAAATGGTAATAATAAATTTGCAAAGACTAGTT
GATTGTGTTCAGTATTACCACCACCAAGCATATATTGCGCGGGCTTTCCACGTTGTTTCTCCAATTGACATGCTTCGCATGTATCAAACTGTCGCTTTTG
AAGCATCAGGCCGTCTACCAAGTTCTGATCGACCATCTTTCTCACATGCTGATGGCATAATTCCCCCACCTTGTCCATGCCAGCTCCGCAAGTCTGCAAC
ACCATCAAGCAGTGCGTAATTCACCATTGTGGTTGGATCGTGCGCCTTCTGAAGCCTATGCAAGAAGTTGTAATAAGCCGTGAACATCCAATGCCGACAC
GATCTTAGTGGCGCTTGTAGAGCAACAGCTTCATTTTCGCTCAACGTGTACGCCCTTTTTTGCGACATTATACTGTACTTTGAAACCCTGCTTCCGTGCT
ACCGACTGGGAGAAAGTGTTTGGATGTTCAGGTGAATAGTAGAAATCTCCGAGTTTAAGCGCGACTTGATCCTCCCTCAAGAACTAGTAGTAAGTTGATC
GTACCGACTCCAACAGGTGCAGTGGGATCATAATATCCATTCACCGTCTTCTCCTTGCATTCGGTATAGGTCAGGTTCCAAAAATCTACAAAGTACCGTT
TAAGTCCGACCAAGTGTCGGTTCGCACTAGTATCGTATACCCAACTTTCGGGCTGGTATCCATCCTGCTATTCTGCTTAAAGTGGAGTACGGGCGCATAA
CAAATCATCCCAATAGCACCGTGAGCTTCTTTTGGTTTGTTTCCCGCACTCGCTCCAGCTCATTTCACCTGTCTATATTGTTTTATAGCGTCCCTAGAAT
TTGAGGTTGTGACTGTTGTTATAAAGCTGCGTCAGTCCGCTTCGCGTATGACAAATTCGCTCGGCCTGAGCTTCTAGCAGATTTATTTGGCCATTCATTT
TGCGCATGCTCGGGCATGTGATAGCAAAATAAATTCTGTAATCACCAGTCCTCATCGTATTGGCCTTGAGTTTACTTCCGGTTATCCCCATAAGTTTTGC
TAAAGCCGAAGTTAACGCCGCCACTATTTGACTTGCTTGGAGATCTTATGCGTGTTGTCCGATCTGAGCTTCCGAAGGCTCGTGACAACATCTGGTCAGC
CTTATTAGCCCTGTCGTAAGTTATTGATATCTCAACGATCTTTTCGGGAGTTTAAACACGATCAAGTCCAGGCTCTACTTTTCTACGCAATCGGTCGAAT
CGTTCTCCCTTAGGAAGAGATGACACTAGAATCCCACTAAAAACTGTGCCATCTAGTGCCATACCAATCGTTTGCATCCGTGTGCGCAGTCAAATCGTAT
TGCTCAAATGTTCTTCAATATGGCTGGTATGCCTGCATCGTGCAGTCTTTAGTTCTGCGTACGAGCGTCGC