Description :
From Genome Similarity Track
Location :
Scaffold_244:17214- 19355
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_244-snap-gene-0.21Endomembrane protein 70

Sequence
2141 bases(100 bases per row)
TAGTCGACCTTGATGGACGCGTAAATCTTGCGCGTAAACCACAGCGAAGACGCGACACCGACGGCACCCGTGAGCAGCGACAACGCACCCGAGATCGCAG
CCATGTAGCCAAAGTaGAGCATCGCGCCGATGAAATTGGTCACGTCGAGGCTCGACCAGTAGTAGTACGCCGAGTACAggaaaaCataGCCACCaCATGC
GCCCGAGACAAGGAACGAACGCCACCACCTGCGAACAACAAGCGATTAACTTTtCCCATACATGCATGGCATGTAAGAAGCGGCTGATGGAACGTACCAG
TTGTAATCCTCAGCGCAGAGCTGGAAGTACGTCAGCACGATGGTGATCTCGGCACACGTCTGCACGAGGATCACGAACGAGAGCAGCAGGAAGCCGAAGA
CGTAGTAGTACTTGTCGGTCCATAACGAAGACAGGACGAAATAAAGCTCGACGAAGATCGCACCGAATGGCAGCACGCCGCCCACAGCCGCCGCCGTCGA
GTGGGACATGTACCATGGCTGCGGAGGGATTGGACGTGGGATGTTGCTCGTCGCGACCGGGAAAGTCATTGGTGGTTTTCTAAGTGATCAAATTcACAAT
AcGCCTGTCAGCTCACACAGTAGACCATCGACATGTTCGTGGAGTTTTCCGTACCTGAAGCCAAAGAATGCGCCGGCAAACACAAGCGGCACCGAGATAC
CcGTCCACAAGAAGAACACCAGCAGCATAGAGCCAAATGGCACGGCAGCATCTGAGCCAGCACCCCAGACGAACAGGTTCAAGAAGAAGAAGAGCGCAAA
CAGCAGACCAGgAaGAGCGTAGCTGTAAGGATCGTGCACAGCTGCCAGCGCTTGCCCTTGAACATCTTGTACGTGCGAGCCGACGTGTAACCAGCGAGCA
CTCCGAGAAGGACGAAGCACACGAGCAACGCGATCATGAGCTTGCCACGGTTtGAAGGTCGAAGCACGCCAACTGCCGCGAAGAAGAGCGTCGTCATCGC
CATACCAAGAAGCTGGTTACCAGTACCAACCATCACGCAGAAGAGCATTGGGTTCTTCGATGGCGGGCGGAACACATCAGCGTGGACAAGCTTCCAGCCT
GACTCCTCGCGTTCCTCTGCACGTTCTTCCTCAGTCGGCACTCGGTTGTAGCGGCTAATATCACGATGCAGGCTGCGCATGAGAATCATACCGACCATAC
CACTCAAGAAGAGCACGATCAGGAGCGCATTGATGATCGAGAACCAATGCACATTGGCGTTGCCTGAACCGGCCTCGAAGTACACGTCCCAACGCGTGCG
CCATtCCTTGTCGTTGTCTTCACGCCACTCGACACTGTACGTCCAGAAAACATGGACTTCGCCCGTCTTGTTGCGTGTCAGGAACATCGGACGGCGAAGC
TCAGGGGAgTGCTTGCACGTCTCCATCTTGTTCTTCTCGGCATCGTAGAGCTTTGCAGGGTATTCGAAACTGAAGGGGAGAACCCAGAAATCGACAATGC
GGCCTTCTTCCGCCGACTCGGTGCCGATCTCGTTATTGTAACCGATAATGATCTTGACGTGGTTATTGAGCTGTGGCACAACTTCCACCTCTGGGTTGAA
GCTACCAAGCTCAAAACCGACGATCATGTTGCCATCCGGGGTCTCCGACTTGACGGGCAAGTTGTCGAGGATCCAGTTGACGCGGTATGCATCCTTGATC
TTGTTCTCGAACTGTTTGATCTCTTCTTCCTTGTATGTCTGCTGACAGAGCACTTTACACTCCTCGTTCTCCATGAACTTGAGCTACATGCATCCGATAA
TCCCCCAAAAAaTATCAGAAAACCATGCTGCATGAGGCCACGTCAGCACATCCACGCACCTCATACGGAGAGTTCTGGATGCGGTTCGCCGTGAGGTATT
CGCCCAAGTTCTCCGACTTGTACTCAATCGACGACGGCTGACAGAAGCCGAGCTTGTAGTAATCGAGCGGCAGCAGCGTCTCGGCCGACGTCAGACTGTT
GaCAAAAAGCGGGATCTGCTCGCCCTTCTTGTACGTCGTCATCTGAACGCCAGGCAGCGAGAACGCATCGGCGCGCAGGGCCAAGAGACCCGTCGCCGCG
AGcaCCGCGACACCCACGGAGCGCAGCATGGGGTGAGGAGG