Description :
From Genome Similarity Track
Location :
contig_59:172128- 174313
Transcript NameFunction/comments
g8998.t1putative alpha 1,3-fucosyltransferase

Sequence
2185 bases(100 bases per row)
CGGATGCCACGAGAAAGCCTCGTTGAACGCCGTCATGTTGGCCACGGGTGCTTCACGACGCATTCGAGTGTACATCTCGGGCGAGTCGTCCACGCGCACA
ACGTACTCGGCGCAATCCTGCAGACTGTCGAATCGGCCACAATCGATGAAGCTCTCGGGGTTAAACAACTCGGACACGGTCTTGGAATCGCCCCAGTACA
CGGGCACACTGCCCGCCAGAAAGGCATTCACCAGCTTCTCCGTCACGTAGCCCGCCGCGCGCGTGTTTTCAAAGGCGAGCACGAACTTGTACGGCGCATA
CCGGCGCACCGCGTCGTCATTGTAGAAAATGGCCAAACGGGATGCCATCTTCGTCTGGTCAGGAGGTCTCGACGACCCCGCACACTTTCCGAGGGTCTAC
AGGTCGAAGAGCATTCAGTGCGTCGTACATGAGCTCGCGGTCGCTTCGATCGCAGTGAGCGTACAAATATGCGCAGAACTTCGTCTTTGGAGACTCGGTT
TTCGTGTCCGAGGGAGACAAAAGCGACAACGGCCCGTGGTCTAGCCGCTCCGCGAAGGACGCACTTGCCATCGACAGGTGGATGTGCTTGGTCCGGTTAG
CGTTCGCTAGCGTCGAGATCAGCAGTACGCGTTCGTCGAGACCATCGGTGCTCCAGGCCTCACCTGACAGCATCACCAACTGCGTCGTTCTATCTGGTTT
TGTTGCACCAGATTTGTTGCGACTGCTGCTATCAACGCTTTTGGCGGTGCCGGCACTGTAGCGCTCGAAGTATTCTGCCACCATCTTCTGGCACGCGGGT
GCTCCTGCTGGATTGCATTTACCACCCAAGGGACTGAAGACAAACACGTCGGGAGAGATACCAAGGTATTTCTCCAGGAGGTTGGCTGGTATCACTAACA
TGGGACGCATTTGCGCCTCAAAAACGGAGGCGAAGAGGCATTCCAGCACAACGTGCGAGTATGACGCGCTAGGTGCATACGCAACGACCAGAGCGGACTT
GGCCGGGTCTGCCTGGAAAAGATTATGCCGCCACAGCTCTCCTCGCGATAGGTCGATGGGTCTTTCTTGCTTGAGTTGGTGGTAGCAGTCTTGGATTTTC
GGCTGTACAGTTGTTGCGAAGTCGAAATAGCTGGCGTTTACGACTGTGAACGGCAGGTGCTGCTTTGCCTCGAGAAAGAGAGACAAAAGGTAGGACGGGA
AGGTGTTTACTGATGAGATATATGAAATCTCGACCCCTGCATTGGTTGGAGCTGACAGCGTTGTCGTCACTTGCAAGTGTCCTGACGAGACGATTCTTGT
GTGGACATCAACCTGCAGTTGGTGCAATTCGTGGCTTGGGATAGGAATTGCGGAGGTCATTTCCAGTTGAGAGGGAGACTTATAGTGATTCCACGTGAGG
CGGTCGAAGTCATGGCAAAACGCTTTGCCTCCAAGAAGGTTCGCGTGGATGATACGGACACCGAGTGGGGATAACTCTGCGAATGAGATTAAATTGTCTC
TGCAGGGCTGGAGAGTAAGATGCGAAAACTGTTGTGTGTTTTCCAGATGAACTTGCATCACTAGTAGCCACAGCCCGACGCTGACATCCTCCAGTCCATT
CAAACTCCGCAGTCGCCAATGATTTCTTGAAAGAAAGCGAGCACAATCCATCGAAATCACGTAGTGAGGACCAAATGCATAGGGTAGAAGCTTGTTCATC
GGATACTGATGCTTTGGCAAATAGTTCTGGTGCGATTCTTGACGAACAGGGGAAGAAATGCGAGTAAAGCTCGAGCCCACGCTTGACCCATATACATCCG
TTTCCTTCTCCCTTTTTGCTGAAGGAGTTGAATTAATTTATCTACTCGCAAGTAGATATCATCATCTGCGATCACATGTACGGCGTTTGTGCGAATTCGG
CCGCCGCAAGGTGGAAAAAAGCCACCACCTTCTCCGCCAAAAGTCCGTAGGAGTCTTCACACTCAAGCTCATCGGTCAGCAGGTCTCCGTACACTTTCTT
CTCCATATTGACTGCATCCTGCAAGTATCGCTGCTCACTCTCGTCGTGTACACCGCGCATGTTTGGGTTACAGCCCAGAAACACCACTTTCGCTCCATAT
TTCCTCGCGTCCTGTGCCCATGTATCTCGAATCGCTTGGCGACGAGCGAAGTTTGTCACCACGGCCGTCTTTATTCCAATCACCA