Description :
From Genome Similarity Track
Location :
Scaffold_1:1720570- 1724480
Transcript NameFunction/comments
Physo_413150Hypothetical protein

Sequence
3910 bases(100 bases per row)
TCTATCGTGGCTTGAAAGGCTAGATTCTGCCATTCCATGTATCGACGAGATCGAATCGACACATATCCTGGGATCCGGGGTATTCGATCTCCGGCCAGCC
ACATCCCGACCGTTCATTCCGATGCAAGACAAGATCTTTGTCACTGATGTTGGTAACCTGGAGATATCTGATCCTGCCGGGTCCTCGGACCACGGTTGGC
ACCCAACGATCTCCACGGGTGACCCATAGCTTTTCTCGATCCGTCACCTTCATTCGTAGCGGAAGCTCGATCGAATCCCCGATCGCGATCTGCATTCCCT
GATCTATACACACGTGTCTGACATTGTCGTTGTATAGCTGACGCCGTCCGCTAAGCTGGATCTTGACTTCGTCGGGGAGACAGATAGAGCCGTCCACAAG
ATCGAGGCGGATCCCCGCTGGAACCATAAAGTCCATACCCAGGATCGCCTCTTGTCCTGATAGATCGCCAACCCAGATATCGAAGAAATACACCAGCGAT
CCCGCCAGCGTAACCTTGATCCTGGTCCTTCCTTCCGTCATGTACACGCTTTCGCCAATTCCCACACATTTCTGGTTCTGACAAGTGACGACATCGCACC
CCACCTTACGAGCAAAGGCGGTGTCCACGTCGATGGACACCTCGGCGCCGGTGTCTAAGAGTAAGATCGACTTCTCATTGTTGATCTTGCCAGTGATCTT
GGCCTGACGGAACCACTTACCTGGCGAATGATGTTTCCAGTACCTTCTGGACTCCCCAGGGAGGAGATCGGGCACCACATCGCCAGATCTGCGGTGTTCG
CTGACGCGAGGCCGACTTCGATCGCTATCATGCTACGGGATCTCGGTCGTCACTTCTCCATCAGCTGGCTTGAACCATTCCTCCGGTCTGCGTTGCTTCC
AATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAGGGCACTTCGGCGTCAGAACGGCTGAAGTCGTCCGACCGATGTAGACTTAAGACCTTGGCGGCAAA
TTTCGCATGCAGGTCACATGTATTACCGCGTAGATCAGTCCGTCCAGTTACTCGATCTACCGTGTTCTTGTTCACGAATGCATAGATGCAGTACCTAGAA
CGCTCGGCTCGAACCGGATTCCAACCCGGCGAGCGTCCTTGTTTAACATCTTCTTGGCGATCGTGGGCAACATGCCAGCGTGCTTCGCCGGGTTGAACCA
TTGACGGATTTGGTTGTAGAATTCCTCCATCGGACACTTGCTCATCTCGTGTAGTTCACCACATCCACGACACACAAACAGGCAGCGATCCGCCGGATGA
CCTCTCTTGCCACACTTCTCGCACGTCAAACGTCTCCAACAATCTAGATCGGTGTGTTTCTGCGATCCACAATGTCAGCAGCGGTTTGATCGCTCCGATC
CGTCAGGTGAAGATCGCGGTCGTGGATCCGATCGAGTGAGTCATGGTTGATCTGCGCCTGGTTGCTCCGATCCGGCTTCGTTGCGTCGCCCCCAGCGTTG
CGGGACTTGTCCTCGGCCGACGCTAGGTAAACGCGGCGTAGATCACCCTCCGAGTCCGATCCGTCTGATCCCGTGTCCGATCCAGACCCCTGGCTCGCGA
TCTGTACTGCACGCACTGCACGCTTGGTTGCAGCAGCTGGTGCTGATGTCGGAACTTTCTGACGATACTTCGATCCAAAGGCGGATCGCTTCTGTCTACT
CTTCGCGCGCTCTCGAGCGCGCAGGACTTCCTCCAGATCTTCCGCGTCCGCAAGCCGGAGTAAAGTGAGCTGATCGGCCAGTTCCGGATCGCCCAGTGTC
TCGATAAAGTGTTCGACATGTTCTCGGCGGGCCTTGGAATCCCAGTCCTTGATCTTCAATCTTGCACGTAGAGCCGCCACATTCAGTCGATAGAGGTACT
CCAACGGCGATTCATCCGATCTCTTGCGAGAATGATAATACTGCCAAGCGACCGATACTCCCAGGCCACAATACTGGATCTGGAAACTCCGGAGTAGATC
GCTCCACTTGTTCCGCGTCGATCGGCCCAGCTGGCGGTACCAGTTCTTCGCCGGGCCCGTCAGTAGATCAGCGAAGGTCAAGCACTTCTCTTCGTCCGTA
GCCTGATCTCGCAGGAACGCCGATTTCACCTTGCTGACCCACGACCGGGCGCGATCTTCGTCCTGATCCTTGCCACTGAACTCCTTGAGATCGGACATCG
CGGAGATTTGCACGCGCTGGATCAAGGAGGACCCAGTGGATCCCGAGGCAGCGGTGGCCACCACAGCAGGGGCCGAACTAGGTACATCAATATCGTCCGG
ATCGTATTCCCACTGGTAGGGACCTTGGTCCGGTGATCCGGCTGATTCCATCTCCACGTCCCGCGATCCAACGTTGTCGTCGACCACTGGAGTAGGTGTT
ACCACCGTGCCCTGTTGTTCCTTCAGAAATCGAGTCATCGCAGCCTGAAAGTAAGACTCCAGTCTGCCATTCGACTTATCGGATCCGGTGGCACTGGTGG
TCCGATCGGTCGACTTGGGTTTCTGCTTCCGAGGTCCTGATCGCATGCGTTCCTGATGTTGACTCCGTGATCGCGCGTCCAACATCGCAGATCCTGAAGG
GCCGAGGGACATCCGTTGGGGTTCAGACGACGTATCCGATACTTGTTCCGCTGCGGAGACATAAGGTGACGACGATCGGTACCCCGTGGACTCCACTCGC
GGCGATGACACTGGAGCTGGCGACACTGGATCTGGCACTTTGGGGTCCGGACTGTCCGCGATCATGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCT
GGATCGCTGTCTGGATCACATCGAGATCTTGATCGCAAAGATCGTTCGCTTCAAAGGCGCCAGCCACGAAGCCGGCTTCCTTCAACAGCCCGAGCAGGTT
CTTCACCGCCATCAGCTTGTTATCCGTCACTCGGGGGGCCGAAATCGGGCCCTTCGGGTCGTCGATCTGCTCTGGCCGCACGATCACCACGACAGGAGCT
TGGCGCAAGAAATCTCTCAGTTCCTTCAAGTAATACTGACGATCCAGGTCAGCCTCAGACCAGTCGAGCGCCGACGGTCTGGGATCTTCGTCGTCCAAGC
CTGGCGCTCTCAGCTTCTTCCTCACGATCTGGGTCTTGTCCACGATCGCGTCCAGGTAGCCCGGATCGAGCCTGATCGGCGAGTCAGCGAACGCGTATCG
ATCTGACCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGTTCCCACCAAGATCCACCGGGGTCCCCGAAGGGACTGGGGAGGATGTTGAGATTTGTCTT
CTAGATCTGTCTCCAGATCGCCCTCGATTCCGTCGACAGAATTCCTCCGAGCACTCTGTCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTCGA
TCCGATATCCGACGACGCCTCTTCCCCTGGTTCTTTCTTCACTTGCGCATCTTCTACGGACTCACGGTGAAACCCGGAGTCCCCAAGAGATCCGGGCACG
CGCACCATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGCCTGATCGAGCTTCCCACCAGCGCCCAGACACCGACTAACGGAGGGGGTTCCCCAA
CGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGGCGGGCTGGATCGGCTCTCTCGGGGCTCCGAAGATGCAGCACTTGGTGAAGATCG
AGTGTCTTGGCGTAACGCGGGGATAGTTTGTGGAGCAGCGCGGTAGTCTTCGCTCTGCGTCCGAGTATACGCTCCGATCGAGGGTTGTTCGCTGCGACCG
ATCGGCCTGGAGTTGATCCAAGGCCTGTAGTTGCCTTTCCGGGTGTGTTCCTTCCTTTCCTGAGCTGCTTGCTGCTTCCTCTAGCGGGATCGAGGTTGAT
CGAGAGGAGA