Description :
From Genome Similarity Track
Location :
Scaffold_1:1720569- 1724498
Transcript NameFunction/comments
Physo_413150Hypothetical protein

Sequence
3929 bases(100 bases per row)
ATCTATCGTGGCTTGAAAGGCTAGATTCTGCCATTCCATGTATCGACGAGATCGAATCGACACATATCCTGGGATCCGGGGTATTCGATCTCCGGCCAGC
CACATCCCGACCGTTCATTCCGATGCAAGACAAGATCTTTGTCACTGATGTTGGTAACCTGGAGATATCTGATCCTGCCGGGTCCTCGGACCACGGTTGG
CACCCAACGATCTCCACGGGTGACCCATAGCTTTTCTCGATCCGTCACCTTCATTCGTAGCGGAAGCTCGATCGAATCCCCGATCGCGATCTGCATTCCC
TGATCTATACACACGTGTCTGACATTGTCGTTGTATAGCTGACGCCGTCCGCTAAGCTGGATCTTGACTTCGTCGGGGAGACAGATAGAGCCGTCCACAA
GATCGAGGCGGATCCCCGCTGGAACCATAAAGTCCATACCCAGGATCGCCTCTTGTCCTGATAGATCGCCAACCCAGATATCGAAGAAATACACCAGCGA
TCCCGCCAGCGTAACCTTGATCCTGGTCCTTCCTTCCGTCATGTACACGCTTTCGCCAATTCCCACACATTTCTGGTTCTGACAAGTGACGACATCGCAC
CCCACCTTACGAGCAAAGGCGGTGTCCACGTCGATGGACACCTCGGCGCCGGTGTCTAAGAGTAAGATCGACTTCTCATTGTTGATCTTGCCAGTGATCT
TGGCCTGACGGAACCACTTACCTGGCGAATGATGTTTCCAGTACCTTCTGGACTCCCCAGGGAGGAGATCGGGCACCACATCGCCAGATCTGCGGTGTTC
GCTGACGCGAGGCCGACTTCGATCGCTATCATGCTACGGGATCTCGGTCGTCACTTCTCCATCAGCTGGCTTGAACCATTCCTCCGGTCTGCGTTGCTTC
CAATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAGGGCACTTCGGCGTCAGAACGGCTGAAGTCGTCCGACCGATGTAGACTTAAGACCTTGGCGGCAA
ATTTCGCATGCAGGTCACATGTATTACCGCGTAGATCAGTCCGTCCAGTTACTCGATCTACCGTGTTCTTGTTCACGAATGCATAGATGCAGTACCTAGA
ACGCTCGGCTCGAACCGGATTCCAACCCGGCGAGCGTCCTTGTTTAACATCTTCTTGGCGATCGTGGGCAACATGCCAGCGTGCTTCGCCGGGTTGAACC
ATTGACGGATTTGGTTGTAGAATTCCTCCATCGGACACTTGCTCATCTCGTGTAGTTCACCACATCCACGACACACAAACAGGCAGCGATCCGCCGGATG
ACCTCTCTTGCCACACTTCTCGCACGTCAAACGTCTCCAACAATCTAGATCGGTGTGTTTCTGCGATCCACAATGTCAGCAGCGGTTTGATCGCTCCGAT
CCGTCAGGTGAAGATCGCGGTCGTGGATCCGATCGAGTGAGTCATGGTTGATCTGCGCCTGGTTGCTCCGATCCGGCTTCGTTGCGTCGCCCCCAGCGTT
GCGGGACTTGTCCTCGGCCGACGCTAGGTAAACGCGGCGTAGATCACCCTCCGAGTCCGATCCGTCTGATCCCGTGTCCGATCCAGACCCCTGGCTCGCG
ATCTGTACTGCACGCACTGCACGCTTGGTTGCAGCAGCTGGTGCTGATGTCGGAACTTTCTGACGATACTTCGATCCAAAGGCGGATCGCTTCTGTCTAC
TCTTCGCGCGCTCTCGAGCGCGCAGGACTTCCTCCAGATCTTCCGCGTCCGCAAGCCGGAGTAAAGTGAGCTGATCGGCCAGTTCCGGATCGCCCAGTGT
CTCGATAAAGTGTTCGACATGTTCTCGGCGGGCCTTGGAATCCCAGTCCTTGATCTTCAATCTTGCACGTAGAGCCGCCACATTCAGTCGATAGAGGTAC
TCCAACGGCGATTCATCCGATCTCTTGCGAGAATGATAATACTGCCAAGCGACCGATACTCCCAGGCCACAATACTGGATCTGGAAACTCCGGAGTAGAT
CGCTCCACTTGTTCCGCGTCGATCGGCCCAGCTGGCGGTACCAGTTCTTCGCCGGGCCCGTCAGTAGATCAGCGAAGGTCAAGCACTTCTCTTCGTCCGT
AGCCTGATCTCGCAGGAACGCCGATTTCACCTTGCTGACCCACGACCGGGCGCGATCTTCGTCCTGATCCTTGCCACTGAACTCCTTGAGATCGGACATC
GCGGAGATTTGCACGCGCTGGATCAAGGAGGACCCAGTGGATCCCGAGGCAGCGGTGGCCACCACAGCAGGGGCCGAACTAGGTACATCAATATCGTCCG
GATCGTATTCCCACTGGTAGGGACCTTGGTCCGGTGATCCGGCTGATTCCATCTCCACGTCCCGCGATCCAACGTTGTCGTCGACCACTGGAGTAGGTGT
TACCACCGTGCCCTGTTGTTCCTTCAGAAATCGAGTCATCGCAGCCTGAAAGTAAGACTCCAGTCTGCCATTCGACTTATCGGATCCGGTGGCACTGGTG
GTCCGATCGGTCGACTTGGGTTTCTGCTTCCGAGGTCCTGATCGCATGCGTTCCTGATGTTGACTCCGTGATCGCGCGTCCAACATCGCAGATCCTGAAG
GGCCGAGGGACATCCGTTGGGGTTCAGACGACGTATCCGATACTTGTTCCGCTGCGGAGACATAAGGTGACGACGATCGGTACCCCGTGGACTCCACTCG
CGGCGATGACACTGGAGCTGGCGACACTGGATCTGGCACTTTGGGGTCCGGACTGTCCGCGATCATGTCGACCAAAGGTCTCAACTTGTCGACCAATGTC
TGGATCGCTGTCTGGATCACATCGAGATCTTGATCGCAAAGATCGTTCGCTTCAAAGGCGCCAGCCACGAAGCCGGCTTCCTTCAACAGCCCGAGCAGGT
TCTTCACCGCCATCAGCTTGTTATCCGTCACTCGGGGGGCCGAAATCGGGCCCTTCGGGTCGTCGATCTGCTCTGGCCGCACGATCACCACGACAGGAGC
TTGGCGCAAGAAATCTCTCAGTTCCTTCAAGTAATACTGACGATCCAGGTCAGCCTCAGACCAGTCGAGCGCCGACGGTCTGGGATCTTCGTCGTCCAAG
CCTGGCGCTCTCAGCTTCTTCCTCACGATCTGGGTCTTGTCCACGATCGCGTCCAGGTAGCCCGGATCGAGCCTGATCGGCGAGTCAGCGAACGCGTATC
GATCTGACCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGTTCCCACCAAGATCCACCGGGGTCCCCGAAGGGACTGGGGAGGATGTTGAGATTTGTCT
TCTAGATCTGTCTCCAGATCGCCCTCGATTCCGTCGACAGAATTCCTCCGAGCACTCTGTCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTCG
ATCCGATATCCGACGACGCCTCTTCCCCTGGTTCTTTCTTCACTTGCGCATCTTCTACGGACTCACGGTGAAACCCGGAGTCCCCAAGAGATCCGGGCAC
GCGCACCATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGCCTGATCGAGCTTCCCACCAGCGCCCAGACACCGACTAACGGAGGGGGTTCCCCA
ACGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGGCGGGCTGGATCGGCTCTCTCGGGGCTCCGAAGATGCAGCACTTGGTGAAGATC
GAGTGTCTTGGCGTAACGCGGGGATAGTTTGTGGAGCAGCGCGGTAGTCTTCGCTCTGCGTCCGAGTATACGCTCCGATCGAGGGTTGTTCGCTGCGACC
GATCGGCCTGGAGTTGATCCAAGGCCTGTAGTTGCCTTTCCGGGTGTGTTCCTTCCTTTCCTGAGCTGCTTGCTGCTTCCTCTAGCGGGATCGAGGTTGA
TCGAGAGGAGAAACGATCGCCGGCCAAGC