Description :
From Genome Similarity Track
Location :
Scaffold_53:17203- 18530
Sequence
1327 bases(100 bases per row)
GGGTCGACACACTCACGCCGACCCGAATCACTGATGATTGACAGCTCCAAATACAAAGCAGCTGAAGAAGATTCTCTGCTGAGATGGTTTGTTGAGCTAG
ATGACGCCATAAGGGCTCGTTACATCGTCGACGAGCAAATGCATGTCGCATTTGCTCAGTTGCACTTGGCAGGGCGTGCGTAGACTTGAGCCTTGGGCCT
CAAGCTACACGACTTATTTGGATCGGGTCGTTATAAGTGTTCAAGTCCCTGCTTAGGCAAACATTCAAAACACTGAGTTCAGGGCTCTCTATGAACTCCT
GAAACTCAAACAAGGCAAACGTGATGTACACTCGTACATTCAGTACATACGACATCTTACGAGTTACATCACAGCAAATCCGCTGAATGAACAAACGTTG
ATCACGTTGTTCATGTAAGGCCTCACGGACGGTCCAGTCAGGACCTATCTCTTTCGGTTGAAATTTGATACCCTGAAGGAGGCAATCCGGGTTGAGGAAC
AAGAAGATTTCAGCGTGACACAAGCTCACGTGGGTTCAAACTCCTATCGTCACCTCGAGGCGACAGGAAAACGGAGGCTCATAACCGACGGACCTCTGTT
ACGCTGAGCACTCAAGTCCTCCCAGTATTAATTATAAGAAATTGCAGACATGCAATAGGTGTCAAAAACAGGGCATTATGCATACGAATGCAGTGCCTCG
AACGCGGTGCCACATACTGCAGGAAACATTCACCGTCAAGCGACCAAGAAGGGTTCAACGCGTGGGTCCGAAGCTGTTGTGAAAATGCAACACCGGAACA
GACAGTCGAAAACGTTCGGGTTTAGTAGGTGCAGAGTACCCTACTGATCCAGAAACGTCAAGTGAATTTGCAGGCCTCTCAACGAGATTTTCTCCCAACA
CGCAATCATTGTGTGTTACTGCATCTGGTAATGAGGTTTCCCTCACTACCTTGAAGCTCGAAGTGGCAAAGGACATGTCACTATGAGCCCTAGTCGATTG
TGGAGCGTCGAACAACTTTGTACGACGCCAGTCGCTTGATGAAAGCAAGCTCAATTTAATTAAGCGCTAGATCCCTCCAACGGGAATGACTGTAGGCCTC
ACTACACGCGCATCCGTAATAGCGCAGAACCGTGTAATGGGAATTTCCTATACACTAAAGAAGTCCAATACGATGAAGAATTTATATCATTGGACTTGGA
CGACAAGTTTGATGTCATCCTCGTTCTACCGTGGATCAGAAGGTACGAGCCACAAGTCAGCTGGCATCGACGAAGTGTCGATATGCCCGCCGCTTTATCA
CCAGACGCCCATCTGATGAACGTCTTG