Description :
From Genome Similarity Track
Location :
Scaffold_43:17203- 30213
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14396ubiquitin-activating enzyme (E1)
Phypa_INRA-310PPTG_143974-nitrophenylphosphatase
Phypa_INRA-310PPTG_14398hypothetical protein
Phypa_INRA-310PPTG_14399actin-like protein 2/3 complex subunit
Phypa_INRA-310PPTG_14400hypothetical protein
Phypa_INRA-310PPTG_14401hypothetical protein
Phypa_INRA-310PPTG_14402hypothetical protein

Sequence
13010 bases(100 bases per row)
GATGGTCAAGACGGTGGGCAGCGGCCAACTCGCGGCTGCGTTCGGCGTCGGCGTGGCGGCTACAATTGCGGCGCAATACGTGTACCAAGTTGCGCTCAAG
CGCAGCTCTTATCTGTCGAAATCGGCTGTAACGACGCCGCGCGGAACGGATGCTTCTGCGCAGGAGTTGCTGGAGGAGCAACTGTCCCGCATTTCCGCCT
TCTTTGGGCCCGAGGGCTTCGCTAAGGTTAAGGACGCGTTCGTGGTGGTTGTGGGGCTCGGTGGTGTTGGATCCCACGCTGCGCACATGTTGGCGCGCTC
AGGCGTCGGCAAGCTTCGGCTCATCGACTTTGACAATGTCACGCTGTCTTCACTGAACCGCCACGCTGTGGCCACCCGCGGTGACGTAGGGCTGTCCAAA
GTCACAGCCATGAAGCGCCACTTGCATGAGATCGTGCCGGACTGCGAGGTCGAGGACATGGCCGTCATGTTCGAGGCAAACAGCGCCGACGAACTGCTGG
AAGGCAACCCCACGTACGTGCTGGACTGCATTGACGACGTTAAGACCAAATGTGCGCTGCTTGAGGCTGTGACTCGCAAGGGACTCAAAGTTATCACAGC
GACTGGAGCTGGTGCCAAGGCTGACCCAACTCGTCTGCAGATTGGATCGTTAAAGGACGCTGTTCGTACGTAACACTGCGGTGTGACTGAGTTGTAGCAA
ACGCTCATGTATTTTTGTTATTATGTGATAGGTGACCCGCTTGCGACGAAGATCCGGTACTTCTTAAAGAAGAAGGGGATTTCGTCGTCGGAGATCACGA
CTATTTTCTCGAGTGAGAAGAGCGTGTGTAAGCTGCTGCCTTTAGATGCTGAGCAGGCGCAGAATCCCGAGCAGTTTGGCAATGTAGAGAACTTCCGCAT
CCGGGTGATCCCCGTGTTGGGCACGATGCCCGCGCTCTTCGGACAGTCCATGGCGGCGTATGTTCTGTGTGATCTGGCTGGTAAGAAGATCAACCCGGAG
GCGGTGGCACGACTGTCACGTGACCAGCGCAACAAGCTGTACCAGAAGTTGCAACAACGTGAACACGTGCTGTTCCACGAAGGCCACAAAATCGAGCTGG
AGAAGGACGAGATTGAGTTCGTGTACCAGGAAATCTGGCGTGGACGTAGCTCTGTGAGTGGAGCGCGTAATGGTGGCCACGACCGCCTGTACTTGGCTCG
CTGGCGAACGGACCGACCACTGGACCCGGACAATGTGGTATACTTGACCACAAAGGAGCTCGCCATTCTAGACAAGAACGGAATCGAAGGGTTTGACCCA
GAGATTGTTGCCCGCATCGATGCTCGTCTGAGTCAGTTCGGAAGCTGGGCGGTTCCTCAGTAGAAATACCATAGAGCTGCGTTATATGCATGTAGAACTG
CAGTAGAATGAGCTGGAGATTTTGTAGACAGCAATTTTGGAGCTTGAAAACTGCAATAGACCGACTCGGTCTAAAATGAAGATGTCACGGTACTCTTTAT
TATGTGACATGTGCCAATGCAACGAAAAGTGTTGATTTCAGTATGGCCTACAGTTTATCATATTAGCACCGTTACCCTTACATCCATGCCAAAATGCTTC
GCATTTCAGTTAGCAATCAGCTAAGCTTACGTACGACCAGCTCCAGTTCCCCCAGTTCCCACAATGGCCACCACGAAGAAAGTGACCCAGCGTCTCGCCT
GCGATTCATTCAAGCAATGGATCCAGGGACTTGACGCCTTCCTTTTCGACTGCGATGGAGGTACGCATACGGTGACTGTGTTGAGACCGTGACGTCATTG
ACACGCAGGTACTAACGAGATTATGATATGACAGTATTGTGGCGCGGGGCTGCCCCGATTGAAGGTGCTGCCAATATGATCAACCTTTTACGCTCGCTCA
ACAAGCGCGTAGTGTTTGTGGTGAGGTGGATCTGCTGCTATTTGGATACAAGTCGAGACTGACGATGTGATGGGAACGATCCTTTTGATTTATTAGACCA
ACAACGCCACTAACAGCCGTGCCACCTACGTGAAGAAACTCGGTGGGTGCCAATATATTGGAGTTGGGTGGATTTAGAGAGATTTAGACGCTAACGGGGA
GTTTTGATGTGCTACAGCGTCGCAGGGCATCACCGCGGTCGAGGCCGACATCGTCACGTGAGTTATGCATTGCTAATCTTCGTAGCGATCATCCAAGCTA
ACATGCTGGCGGCTGTTTGTTAAACTATAGTTCGGCGTGGGCTACGGCGCAGTACATGAAGCAGCACAAAATTGAGGGCAAAGTGTACATCGTCGGTGAG
GCCGGTCTCAAGACCGAACTGGAGTTGGAGGGCTACAAGGTCAGTGGCTTGGAGCACAGCGACATCAAGGGTCTCCCGCACGTGCCGGATATCGACATGG
AGACGAAGGCGGTTGTCTGTGGCTTGGACAGGTATTGAAATTATTTGGACGCCGCGTCCTCTCAAGCAACAGTACTAACGTTGTCTTTCTGACATCGTGA
TATTCTGCAGATACTTCACCTACTACAAGATGGCGTACGCTACGGCATGTGTGCGTCAGATCCCTGGCTGCCACTTCATTGGCACCAACCCGTAAGTTTC
TGCTCGTTCAAGCGATGCGCTTGACCATCTTTTACAATTGTTTTCCATTATGACACAGTGACTCCACGTATCCGACGGATGGCGCCATTATCCCGGGCGG
AGGCTCCCTCGTTCACATGCTGGAGTGCTCTATTGGCCAGTACGTATAATTTTGTGTTGTCTTGTAATTCTTAGTGCACGCATGCTTATCATTTGCGTTA
TTATTTATGCTTATAGCCCCCCTGAAGCCGTGTGCGGTAAGCCTTCGCAAGATCTGCTGCAGACCATTGTTGCCACGTACAAGTTGGACCCCTCGCGCAC
GTGCATGGTGTGAAAGCTGCAATTTGCAATACTTAGTGACCTGCGCTGAGCTTGTTCCGTGTCAATTTCACAAATAGGTTGGTGACCGTCTTTCGACGGA
CATCGAGTTTGGCAATGCTGGTGGCCTCCACACGTTGCTGGTGCTGACTGGAATCACGCACGAATCGGAGCTGGGCAGCATCGAAAACGCCCTCCACGTG
CCTGACCACTACGTCGATTCGGTTGATGTGATCAACCAGCTCCACGCCGAGACGCTTGAGAATTAAAATTGGTCTCTTGTGTGATCTGTTGATCGAACTC
AATTCAATAGACGCAGTGTGATCGACTTTAGTATTTTCAGGTGCTTTCAAGTTGAGTTCACAGCATCAACACTGAGTTTTATTGATACAACTAATTTCAC
GTCGTGGTTGGTATATTACACTATGAACACCCTGGTTTATACTGACGGTGATCCACCTCGAGCCTTCGTTTTCAGTCTTGGAATCGATCCATTACTACCA
CTGTTGACAAAAGCGTCGAACATGGAGAACCCACCGCCATTTGCGGCAGCATTAACACCACCTGCTGGAGTGCCAAAACTGTTAGCTTTGGTAGTCTTCT
TCGGTCGAATCGGAGCTGAATTCAGTCGACGTGTAGTAGGTGCAGCTGTGGGGCGAATACTTGCGCTACGAGGTCCTGGTGACGCAGCCCTTTGCTTGGT
GGGGCCCGAAGCGACCACTGGAGACACCAGAGGGGTTGGAGTCCGCAGATATCGTGGCATCGGTGACTTGACCAAACGCTTCGTGATCTCTAGGAACTGC
AGTTTCTTGGTGGGCGTCACGTCTCCTTCTACCGCTCCCCTTGGTCTCTTTCGCGTTGGGGCTCGTACATTTTCCGGTGAGTCATTATCGCTAATGAGTC
CACTGCTGTTCAAGCTGATGTTCAAATCTCCCTCCTCGATCATTTGGTCGCGTCGGGGTGCGTCTAACTCCGCTGTATCACTCGCTAACACCTTCCGGAA
CTCTGCTCGTTTTGCCGCCAACATCTTTGCCGCTTCTTCTTTCTGGCCCTTCTTGGTATTCTTACCCAACACTTTTGGAGTGCTCATATCTTGCACCTTG
TTCATTCGAGCAAGCAGCTCAGCATTCGCCAATCGCTGCTTGATGGACATCTTCTCATTTTTCCCGTTAACCTTCGTCTTTGTTGGCGGGATCGTAGAAT
CTCCTTCTCCAGATGTCTTTGCAGACTTCGACTTCGTCTTAGACTGCGTATCCTTGCCAACATTATTCCCCACAGTCTTTTTCCGCATATTATTGCTGCC
TGCTGAAGTTGTTTTGGCATCATTCTTTACAGCGTTTATGTCATCTTCCTTTGCTTTGACTGCCATCGTGGTATTTGCCGTACCCGGCATCGAGCTCATC
GCTCTCGATACGGCTTCTTTCAGGTCCTTTCGACGTCTAAGACGCTTCTTTGGTGTCGATGCGGGCATTGGCTCGGGTTCAGCCTCTGCTTCGTCGCTCT
CCTCCTGCTCAGCTTGAGTAGCAACCCCCGCAAGTTTTGTCTGCCTCCTCGCTTCCGCGTTCGTAAAGTTAAAATCTAGTGGCGGACCTCCCCTCCTCTT
CGCAAATCGTTTCGTAGACGTAATTGTCTTCTTTTTCACCGGTGATTTCTGCACTCGCTTAGGAGATTCCTGAGCGACCGGCAGAATCAGACTCACCATA
GACGGCTCGTCATCATCGTCCGAGTCGCTATCCTTGTCAAGCGACAACATGCTCAGGAGTCCATCGTTCGGTAGCTCTGGCGGGGGGCTATCATACCCTT
CGAGACCCTTCTGGTTCTCTGAAACGGAGTCTTCTTCGGGCTGCGCCGACGGTAAACTAATAGGTGTAATCCTCTTCGGCAGTGCTGGCTTCGTCTTCTG
ACTCTGCGTAGGCTGCATCTTGGTTTTCAATTCTTTACGTTTGACTGTCTTTGTTCTCGCCTCTTTAGCTTTAGCTGTCTTGGCCTCCTTCTTCTTACTC
GACACAGGTTCCTCTTCATCCGTCTGCGTTCCGCTAGCCGCCACCTGCTTCACCTTCTTTTGTCTCTCTGCTTCTTCCCGCTGCTTCTCCCTATACAAAG
CTTCTTTCGTTTCCTGCTCACGCTCGGCCTGCTCTCGTGCCTGCTTCTCCTGTTCCTGTCGCTTCAGTCTACGCAATTGCCGCTTGTACCTCAGCTCCTC
CATCTCCATTTCCTCTCCCAGCAAGAGCTGTTGCCATGTTTTCTGTAGTCGCTGGCACCGCAGCTCGATGGACTCCCACTGTACACCGCATTGAGAATAA
GCATAAGTTAGAAAGCTAATATCTCGGAGTCTACATGGAAAACGCACGCACTTCCAAGTTGTACGCCTCGAGCAGGATCTCTTCGGGATAAGGACCCCCC
ATATGGTCCGTGGTATTGTCCCACGACTCCATGCGAACCTGCGTCGCGGAGCCGCTTGAGCACGTCGAGAATAAACGTTTTCCTCGCGCGCCGTGGCGAT
TCAAATTTTAAGTGCATTTGAGGTGAGGCACACCATTTGCGTGGTGTGCCACATCATAGTTGAAGTTGTTCTTGTAGAGAGATCTAGGAGACATTTCCCC
CTCTACAAGATCGAGACCATAATCCCTTCGTCGAAGCAGATCAATCTCAAAAGGGAGTCAGTTGATACAAACAGCAAGACAATTTTGCACTATGGTAGCA
GGGGGCGACGCGAATCTCTTCCAGCTAGCGGACGGCATCTCGTGCCACGCATGGAACAAGGACCGCTCCAAACTGGCAATATGCCCCAACTCGAACGAGA
TCTGGATCTACTCGGGCTGCCACGTGCCGGATCCGTCGCAATGGCGCAAAGAGGCTGTGCTCACAGAGCACGATATGCTCGTGTGCGGCCTAGACTGGTC
GCCTGTGCATGACCAGCTCGTATCCTGCTCTCATGATCGCAGCGCCTTTGTGTGGAAGTATGAGGCCGCCTATCGTCAGTGGAAGCCGCTGCTCGTGGTG
CTGCGCATCACACGCGCTGCCACAAATGTCAAGTGGAGTCCTGATGGTAAGAACAGAACTGGACGAGGGAGTTGATACAGTGCTAACGGCTATTGACTTT
AGGCAAGAAGTTCGCGGTGAGTAGTGGTGCGAAATGCGTGTCCGTGTGTTACTACCAGGCGGCGGAGAACTGGTGGGTCAGCAAGATCATCAAGAAACAC
AAGTCCACGTACGTAGCTTCAACTTGGGATTTTTATTGAGCTTGGATGCGGATTCTGAGCCTATGACCTGTAGGGTGACAGACTTGGACTGGCACCCTAA
CAGCCAGTTGCTAGTGACTGGCAGCACGGACCTCAAGTGCCGCGTGTTCTCGGCGTACATCAGCGATATCGACGGGCAGCCTGATGCCGGTCCGTTTGAA
GCCTTGCCGCCGTTCGGTGAGCCCCTGGCAGAGTTCGACAATGCCAGCGCGTGGGTGAACGCTGTCGGGTGGTCCCCCAAGGGCAACCGCTTGGCGTTCG
CCGGCCAAGGATCATCCATTCACATCGTTCACTTTGGGGCACCTGGCGAATACCCTACGATTCAGGTACTGTGGGTTGAATTTTCTTGTGCACAAGTATG
GTAGCTGATGTTGTGGATTTGGGTACAGTCGATCCGTTTCTCGCACCTCCCGCTGATGCGCATTATGTTCCTGTCGAACTCCGCGATTGTCGGAGTTGGC
TACGACTTCAACCCTCTGCTGTTCTCCCAGGACGCCAACAACTTCTGGTACGTATTTCACGAATGTGTAATGTATCATTGTATTTGGATTAACCAAGTCC
ATAATATCTAGGTCGTTCTCTGAGTTTGTCGACAAGAAGCCGACTGAGAGTGCTGTCAAGAAAAACGCCGGTGGCTTCAACGCTGGTAAGAGCAGAACTG
TTGGCTTGACTGCAACTGGATACTCACTTGTCTCGCGTGTTTTAATGCAGCTCGGAGCTTGTTTGAAAGCAAGGTGACGCGAGGCCAGTCGTCTGATGCC
ACTCAGCACGATAAGAATATGCTGTGGATGTACGTTCGACCAAGTCCAAGGACTATTTTTCGTTACTAACATTTCATACTGCGCTGCAGGAAACATGAGA
GCAACATCACATGCATTCAGCCTTACGCCAAATCCGCCTCTGGTGGTGTCACGGAATTCTCCACCTCGGGTACGACTCGCACAAAAGCTGATGAATTCTA
TGTTTTGCGATATGCTAATTATTATGCTGATGATGTTTACTGAAGCTCTTGACGGTCGCGTTGTCCTATGGAAGCTGGGAAGTTTGAACGTGCAATTGAG
CAAGCTTCATCTGTAAGAGGGCACGCTCTTTTTCTCGGACAAAGTTAAGGCTCTGCAATTTACCTGTAGACTCAAAAGCAGCATTAAAAGCACCCGCTAG
TGTCACCTGCGCAACGCTAACGAAGCGAGCCTGAGACCAGCACAGATAACAAGATCGGATTTCTACTTGTGATTGCTCTGTACACCCGACACTAACAAGC
GCAATGACACCTCTATTCGTACATCCGCTTTAGTCGTCTATACTCCTGGCGATACTGGTTCTCAACGACAGAGGCTTGGCGGAAGTTTTTCCACTCAGGA
AACTCCGTGAGCAGCACCTCCGGGTCGTAGGAAAGCAGCAACTGGATGCCCTGACTAACGTCGTTCAGCGTACGAGCGAGATCGATATGATCCGGGTTCA
GGTACGTTCGCTGCAGTTCGAGCAGCTCATAACTGCTACGCAGGAACAGGATCGAGTACTCGCATACACGCTCAGTCTTACCACGCAGCAGTAAGTCGCA
TGAGTCTGCTACCAGTTTGTGGATACGCATAAATACCAAGTGGTCGTGCGCCACGATCTCCAGTGCATCTGATAGCGTCTCCAATGCCACGGACAGCGCA
TCAGCAGCACTTTCGGGGTTTGTCTTGATAATCTCTTCTGCTCCAACCAGCACCTTCTCCAAGTCCGGCATACCAGGCTTTGTGCCGTCATTGTCTTCCG
TTGCACTCGGAAGCGGATGTAGCACACTGTCGCCTCGCTTGCAAAGCTCACAGCAGCACTTGAATCCGAACTGCTCCCATAAATTCTTCTGTCTGTTCTC
ACGACTCTGCTCACGTGGATACAAGTACGAGATCGTCAGCTGTTCGCCCTTGGCGATAGGTCGCGCGACCCGCACCTCGGACACTCCACCTTCGGGACCA
GCACCTTCTGGCGTAAACTTGACGCAGTTCGGGTTGCAGTCGTGGTTAAACATGGCGTTATACAAAAACACGCCACTGTCAAAGGCATTGCATTGCATAG
CAAACACGTTCTGTAGCACCTGGTCGTGTGATAGTGCTAGTTCGCTGAAGTTCTTGCTCAGCTCGTCCACCTGGGGGCCGTACTTCTCTCGGCCTGCAGA
GAGCAGCCCCTCGGGCAATTCACTGAGCTTCTCAGGGTATAGATGGCTCAAATGCTCCATGATTTCAGCATAGTCTGGTCGCGATAGCACTGATTCCATC
GTGGCCAAGAAGAACTCAGGGTCGGACGTCTCCACATCACTCGGCCATGGTACATACACCTGCTCAACCAGAACCTGCGTTCCCGGTTTTAAATCTCTCG
TGGCCACATAACCTCGAGACCCTCCGACGCTGTTGAAGCTCGTCACCAAGTCGATAGGGCCCACCGCCAGCGGTTTAACGTCGTCCCAAGGTTCGTACAG
ACTACGCGTGACTTCAGTGGTAGATTTCTGCTCTTCCTTCGCAGCAGGAGAAGGAGTAGAAGCCGTAGGAACGATATGCACGACCTCATGAGGTGTCACA
AGCGGTGTCGTCGTCTCCTCGTCGCTACTGTCGTCGTCGAAGAGCTCGAAGGCCGCCTGCACTGACGCACTGGCCTTGCCACTCATGCTGGTTGGACTGA
CGTCGAGTTTATCAACTCGTGTACAGTACATCATTAGTGTACGTTATGTGTACCGGTACCTACGAATTCTTCTTTCCCTCTCTACAACAACCAAGTCAAA
ATCCAAAGTACCGACACCTCCCTTTTGTGGTCACCCGCACTCTGGACGCGTCTCACATGGCAGAAGACTTGAGTGTCACGCCGGTCACAGGGCGAAAGCA
CCCGCGGGCCCCGATGCAGCAGATGCAGCAGCAGCTCCTGCCTCCTGATGCCACACTGCCCACCTTCGTGTCCGACTCTCCTATCCAACCTCCGCAGCAG
AGTGATGATCTTGCGCGCCCTGCGGCGTCCAGCACGTCAGGACTGCCACTCGGGCGCCGCATGCGCCTGACGCTCGGCCAGAAGCGCGAGGTGGTAGACC
TGGCAGCCAGTAAGAAGTTCACGCACCGCGAGCTAGCTGAAAAGTTCCGTGTAGGACGCACCACTATCACCAATATCTGCAGACAGGAGGACCTCATCCG
CACCGAGACAGACTCGGCTGACGCTACAAAGAAGAAACGGAAGACCACCAAGTGCACGTATGATCTGCGGGTGCTGGACGAGTGTTTGCATAAGTGGAGA
ATGGAGGTGAAGGTTTCCAGTCCCGATACTAAGCTCACTGGCACCGTTTTGCAGCATAAGGCCATGGAATTGGCCTGTAAGATTGTTCAAGAGCCTTATG
CAGCGCTACCTGACAAGGTGAAGCAGGCATTGCAGAAGTTCACGGGCTCCAATGGCTGGCTAGACGGATACAGGACCAGATTCGGCTCGTTCAGCAGCAA
GCAGCTGCCTGGAGGAGGAGATCAGAGTGTTATCAAGAGTGTGGACATCCAGACGAGACTCCGAGAACTACACCACGCTTTTAATAATGTGGATATTGAG
GATATTTGGACGGGCAGTGAGTTCGCAGTCATGTACAAGCCACCGGTGTCTGAGTCGGTTAGTGGCAATGGCAACAATGGCCGGTACACGGTCTCACTGT
TCGTGAGTGCTGCTGGAGAGAAGCACGATTTGCAAGTCATTGGTACGGACCGCAACCCGCTGCTATTGGAAGGAATTGACACCAAGGAGACGTTCAATAT
TCAGTATGGATATTCGAAGACTGGTTGGCAGGTGGCACAGACGACTGTGAGCATGCTCAAGTCGTTGAATGCACTTGCTAAGGAACGTAAACGCACGTTC
CGAGTGATTTTGGACTCGGCCGTGCCTCATGTAAAGGCTGCTATGATTTTGGATTCGCAGGGAGACCAACGCACGTTCTTTGTGTACGATCATCTTCAGA
TTTACTTCTTGCCGCCTAATTTCAAGGCTCCACGTTTTCACCCCTGCCATCTTGGCGTGATTCAAGCGTTCAAGGCACGTTTCCGCGGTGAGATGGTGGA
AACGCTGTTCAATAATTATCGACAGAGTTTGATGAGCCAAGACCCTCGTGGCTTTCACCCTCAGCGCCACTTGCACACTCGCAACGTTTTCCACTGGTTT
TACGTGGCTCTTCACAGTCTTGACAAGCAGCTAATCCAGAGTTGCTGGGTTCGCAGTGGGTTGCTCCCCACCCAGGCTATTGCGTCGCTCAACTTGCGTA
TCATCTTGAGCAACAGCGCCAACGGTTCTTCTCCCAGCAGCGGTACAGACAGTGGCAACGGCAGCGTACATTCTGATGCGACTGGAGTGTATGGTGTATC
TCCTACCGGCTCACTCAATGGTGCTGGGTCGTCGCTGGTGGGCAACGGAAGTTTACCATCTCCAACGCTATTATATCGCGAACTGCAGCAGCAGTTGAGT
AGTATCGCCCAACTTGCTCCTGACTTCTTACGCTGGATTGGCGTGACTGAGCCTGCGAATGCTCAGGTGTTTGTTGATCTCGAAGGCAACGCTTCTGTGA
CTGATCCTGGAATCGACGAGGTTCAGATCATCCGCGGCGTTCTCCAAAAGCACGGATACTTATCTACTAAACGGCTTGACGACGAAAGCCATGCAAATGG
ACCATACGAAACCTTCGAAGACGTCGCTGATGAGCCCTGTCCGCGACCAGAAGAAGTGCTCGCGTCAATTGGGATCCTGAAGCGATATCTGCGTTTGTCT
CGTGATGCGATTCCAAACCGTGTTGATGCGATTGTGCAACTGAACGACGTCAAGAAAGCCGTTGACGGTGCAGCTTTCCGTGACGCCGCTATTTGAGTGC
AAGTGCGTGTGCAGTACTGGTTTATAAGTACTTGTTGGCATCGTGTTCACTGTATTATCACTATTGTCTTGTATCATTTATCTTACACACGTTTTAGCAG
TCGAGCTAGTACACGTTCCGGATTTTATAGTTGGGAGGAATGACGGGCGCTTCATCCAACCGCAAATTTGTTTGCGCTGCAACTGGGGACAACAAGGGTG
CAGCTCGTGCGGGTAAAGGCATGGGAGGCACCAGATCAGACAGATCGTCTTCCAGCGGGAGTATTGTTCGCTCAGCAATAGCCTGCTGCTCCATGCGTCG
TTGACGCCTTGCATAGGCTACAAGTGTACGTAGCGCACTCACCAACCAGTCTCGATGACTTGAACTCTGTGTCTCTAGATCCAGTGTACGTCCTCGGAAT
ACAACCGAGAAAGAGCACGCTTCAAGGACACTATTGGAAGGGTACTTGCGAAACACAGCGGTCTGTCTGCCGTCCAGCACTTGCAGTACCTCTGCCAAAT
CGACGGCTTCACTAAGGCCTCCGCGCTTATGCTGCCACTGCACAGTTCCACAACAATTGCAATGCAGTCTGGTGGCATGCGCACCTCCACGCCGTCCGTA
CTTGAGCAGAGGGAAGAACATATTGATCGCCTGCACCAGATACGACCGATGCTTGCCACCAAAGCGGAAGGCCAACTCGACGATCTTCCACCGTGCACCT
TCGATCGTCTCGAGCTCTTCGTCTGTGAACAAATACGTCTTACGCTTCTTCCGCAAATGGAGAGACTCCAATACACGCGGACCGATCCTCGAGAACGCGC
TCTTCTTGTGTTTCTTGCCAGGATGCATCTCCTGCGGGGCCAGCGCGGGGCTAAACGGAGGAGGTGTCGGCATCGAAGACCCATCGATCGGCGACGGCAC
GCCAAGGTCGTATGCAGTCGGACATGATCCAGCTCTCCTCCGGGTCGGGGCAGGCCTCGACTTGAGGCGGATTCCATGAGATTGGGCCAATGGTTTACCC
AGATGATCCGAGTCGTCTTTCAGTTGGATCACTAGCCGTCGTACACTCGACGTAAGTTGGTCCTGTGCTGACAACGCCGCTTGTTCAGCTGCACAGCTCA
GTAGTCGAGTTTGTCGACGCTGTAGGAGCAGGTGCTTGGAGGGACTCGGCTCTTGCATCACATCTAGCTCCGTCTGAATTACCGCTTCTTCTTGCTCGCT
ACTGGATCGTTCCTCGTCCTGTTCAGAGTTATCTCCGTCCAGCTCGAGCTCTTCCACGTCATCAACATGATCGACGTCTTCATCGTCATCGTCATCGTCT
TCCTCGTCGTCATCGTCATCGTCATCGTCCTGGTTCGACATATCTTCAGGTACGTCCGACTCGCTCATCAGGCTCTCGCTCATGATCCTGCTCATTAACC
TGCGCACGCTCCTCGGCATGTTGACCGAGTCAAAATCCAGCAACTCCTCGTCCAGCTCCTCCTCGGTACTGTGCGCACGCCGTTCCTCCTCTTCCAAATG
CTCCTGCTCATTGTTGTCCATGTGCCTGACTTCTTTGACATCCTTCTTAAACATTTTCTTATCTTCCTGGTCGTTCGGAGGCGACGACGAGGGTGCGAAC
CTAGCGTGCACAGCACCAAAGTCCTTCATTTCCGCTTCGAGCGTCGCTCTCCGCATTAGTTCCGCCTGACTCAACGGCTTTGCCAACGCCGCCGCCACCA
GTGGCCGCGCTGGATAAAACTGGAGCCGTTGATTCGTGCCTCGGCCGTTAGTTTTGGGATCCCACATGGTCATATTCGACTGCATCGAGGGCGTCGCGCC
GACACTGCGGCGCCGCGCGTGCCGTTCTTGACACCGCGCTGCCCTGTCGTCGTCGCTCTCCTTTTCCTCGCTGTTATTGCTGCTGAAGCTGCTGCTGCTG
CCCCGCGAATCCTCTGGTTCGGCCTGGAATACACTGCCACGTCGCACGATGGCCGACAGCTTGCCCAGCAGCACGACGCTGGACGAGCGCTCGCGACGAC
CGCCCGACCA