Description :
From Genome Similarity Track
Location :
Scaffold_30:172012- 175453
Sequence
3441 bases(100 bases per row)
ATTGCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCACCGTCCTCAAGGATGCGTGGTCTGTGTAGATCACGAAGGGCCGAGAGCCCAGAAGGTGAAC
ACGAAGCTTCACAAGGACATATTTCATTGCCAGGAGCTCCGTGTCGTGGACAGGGTAGCTCCGCTCGGCGGCTTTGAACTGCCAGGACTAGAACGAGATG
ACTCGTTCGTGTACAGCCGTGCCGGTCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACTACGCTAAACGGCTTCGTCTGATCCGGCA
GGGCCAGGACAGGGGCCTCTTGGAGACTGACCTTGATGCTGTCAAAAGCATCCTGGTGCTCTAGCTTCCAGCGCCAGTCGGCGTCCTTCTGAAGGAGGCT
CGACAAGGGCTTAGCGAAGCCTGCGTACGCTTCGCTGTACTTGTGAAGGTAGGTGGCCAAGCCCAATCACTTTCGAAGATCCTTCTGAGATCGGGGCATC
GGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGC
ACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATTACGTCCAACACTCGACGGAGGTGTCCTAGATGTACCTCCATGGCCGTCTTGCCTCCCTCGTC
ACGGCTATGGACGAATATGTCGTCGAGGTACGTCTGTACGAAGGTACGCAAAAGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTA
GACAAGCCCTGCGGCATCACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGT
ATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTGCCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGC
GTTGTTCAGCTTGTTATAAGCGTGAGCCAGACGCCACTTTCCGTTCGGCTTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTTGACTCCCGCACC
ATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCA
CGAGATCAATCTCGTGTCTTACGCCTCGATCCGGTGGGAGTTGGGTCGGTGATTGTTCACCACGTCCGCATACTCCGTCACCAAATAATACACCGGATCC
TTGGGGTTCTTAAGGATCTCAGAACCCAAGCGCGTCTGACGCTGCTTGTTTAGGTCTTCCAGGACGTTCTCGTTCAAGACAGAGGAGGAGTTCAGCTCCT
CCGAGTGGACTCAGGTCTCGTGAGCACCATCTCAGCAATCTATCCAGCCTTGAGGTTTGCCAGGAAAGACTCAACCGTCATTTCCTTCAGGATCAGTATC
TGCAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTATTCCGGTCTCGCCATCGAAGACGTGATAACCGTCTTTCACCGGCCTTGTC
GTAGGAGCCCGGTCCCCGGACTCCGAGTCGCTTGAAGCGAAGTCGATCTGAACGAAGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCGTTGACGACGGC
GACCGTGACGTGGAGCTTTGCTGCCCACGTCTAGGGATGTCGGTGCTACAACATCCGAGGCACTCGTGGCCTCGTGTGGTACTGTGGTACCCACACAGGA
AGCGTGTTCGACACCTTCCTCTTCACTTAAGGTCCGGGCGACCGTGAGTGAAATTCTGTTACCCACTCTGAACACGCTGTTCTCGGTGTCCATGACAGCT
GCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAATTACCCACTTGGCCAGCGCCTCTTCTGGGCGCTGCCACCATCAGAGCATCCTCGGAGC
CGTCATATACGTCGACGACCCCCAAGCATCTGCCGATTGCTTTGGTACCCAGGCAGCCCTTGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACC
CACCAATGCTCTGTCGGACTGCGCAGGGCGGCTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCTGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAAG
ATCATATCATATGGATCCATATCGAGAACAGTGAACAGTTCGAGGCTGTCAAAGTCTTCAAACTTATCAGCCAGATCCACTTGGACGTTGGGGACAGTGA
CGACCTTCCCGTCGGCCAGTCGCACTGACACCGTTCCGTTGTCCTTGCTTTCTTTCAAAGCATCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCG
GCGTGCGAAATTCTTCGACGCCCCAGAATCGATCAAGATTCTAAAGGGATGATCGTATCCCCGTACACATTCGTGTACTACGAGCAATCCGCCGCTGCTC
TTCGCCGGTTCGAGAGTGCGAAAACTCTCAGGGGCTAAGTTCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGC
GCCCCGCTCCTACTGGTTCCCGGCGTTCCCCTGTCCCCGGGCTCCTGGCTCCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGT
CTTTCCGCGGGACTGTCGCGCTTAAAGTGACCCATCTTCCCGCAGCCGAAGCAGCGGATATCCCGCTGTTCGGCGGACCCGAGCTCCATGGGAACTGGTC
CGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCCGAGGCCGGCGTACACGCCTGGCGATGGTTGTACTCTTCTTGAAGAGCCAC
TTAAATCGCCTCTTCAAGGGTGCTTGACTGCACCCGGAACAGCTGGGTGCGTGCGGGGCTCACTCGAAGGCCGTCCATGAACACAGCCATCTTGATGTGT
TCGCTGAGTGGGTTTCCCACTAGGGACGCCGTGAACTCCCGTATCTCGTGCACGTACTCGTGCAGTTCACGCCTCCCTTGTTTACACGAGAGGAAGCGCG
ATCGCTGGCGGTACTCAAAGTTCGCCGGGAGGAACGCGGCTAGGAGCTGTTCACACAGCTGAGCCCAGGATGCGAAACATCCAGGTGATGTTGCTTCCCG
TGTGTACACCCAACTCTTAGCACGGCCGCTAAGGTTGGAGAGTGCAAAAGCAACACGAAGTTGCTCGGTCGAGATCAGAGCCGCTTCCATCGCGAGCTCT
ACATCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCGTACGGCTTAACCTTCAGCCGTATTGGCTTCGGGTGAGGCGGATTTGCTTCCGCCG
CCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCC