Description :
From Genome Similarity Track
Location :
Scaffold_1127:172- 4170
Sequence
3998 bases(100 bases per row)
CATGGCACGGGGAAATGCCGACACCCAGTAGGCGCGGGGCGCCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTTAGGAGGTAAAGTTGAACAGGGCT
TAGCCCCAAAGAGTTCCACACCTACTGGTATGGAGCGTGGATACAAATCTGGCTTGTTGATCGCTGAGGCGAAGGTTTAGGGTTTGAAAAGCCTTGGTCG
ATTTTAATCGATTCTGGGGCGTCTTGCAAATATGCTCGACGTCGTTCCCTTGAGGGAAGTCAGCGTTATGCTGAAGCGCTTACAGCGCATGAGGGTGATT
CAATCACGGTTCGTTTAGCAACAGGAAGTCATGTGACTGTACCTAAAGTTCCGTTGAACTTAGGTATAAAGTTTGTGGACTTTGATAGCATTGAACGCTG
TCTTTTCCTTGATTTGGACTCGAGATATGATCTCATCCTAGGTGTGGCTTGGCTTGAACGCCATGAGCCATGGATTGATTGGAGGTCTAAGATCTTAGGC
GTTACGCGCAATGTTCCTAGTGAAGCTTTGGAGAGTCATGAACCCACCTTTGCTAGGCAAAAAAAACACTATTGGCGCAAGCCTTTGACAGAAGATGTCA
ATGTGCTGGACATTGGAATGTCTGAGTTAACTAACTCCAATGTTGAAAACATGAATTCCAAGCGTATCTCGTTGAATATTAGTGATACGGCACGTACTTC
GTTGAGTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAATCATGGTTGGCCTAGGGCCGAGTTATCAATATGATTTCTTTGATGTGTATGTGGTG
GCACGTGAAAATGTACCAAGTGTGGTCGGCCGTGAAGGCACCACACTTAATGTCGGTAATGACATTGTTGGCGAAACGCCATTAAGTTCAGGGCTAGGCC
TGTAAAATGTACGTGGAGTGGCACTATTAAATCCGCTGGGTGAAGTGTTCTAGTTACGTAACACTTCATCGGATGTTGGTCAAGACATCAGCTCTCGTAT
AGAGCCTACTACTACTACTAGTAACCACGGGGACACTATTGTCCCGATCCCAGAGGGGTGTAAGGTCTCATCGAAGAGACGACCTGGATGCCATGTGGCA
ACTGTTAAGCGCCAGGCGTCCGAGCAGTCACATAGTGACAATAGTGATACACTATATACACTTGTCAACGGAGTAACTTGCCAGGTTGAGGGCAATGTTA
GCCTGGAAACCCTTCCATATTTGGATGCTCTTTGTGAGCTAGACGAAGTGTCTGATGGCGAGTTTTGTCAGGCCTTGAAGACAGGAGATTTATCCGAATT
AGTGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCTCATTAATAGATGAGTCGGTCCTAGAGGACACCAAGGCGACACTCAGTGCCCGGAGTGGATCT
TCGATCCTTAAAAATCCTTTGGATCCATTCTATCCTTTGGTAAAGGAATTTCAAGATGTGGTGTGTCACAATCCACCATCTGTCTTACCTCCCGGTAGAG
TTGTACGTCATGAAATTGACCTAGTTCCAGTAGCTAAATACTGCGTAACATGGCAATGGCCTTTACCTAAGGAACAGTGTGACGTCATTGACGATTTCTT
TCGTGCTAAGCATGCGGCGGGAATGGTGCGGGAGAGTGAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGTG
CACGCTTATAATAAGCTTAATGCTGCCACTATCCCGGCTCAGACACCAATCTCTAGAAAGGATGTTTTTCAGAACAATATGGTGGGATGTACATTGTACA
GTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAACACCCCGAGCGGTATGCTATAGGAGTG
GCTCGTTATGCCACAAGGGCTGTCAAATGCCACGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTT
GATGACATCTTTGTCCATAGTCGTGCAACGAACAGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCGAATAAATT
GTATGAAAATGCATCTAGATGCATCTTTGCTTCAGAAGAGATTTCCTTTCTGGGATGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACACCGCTAAGGTA
AGGTCCATAGTCGATTGGCCGGTTCTAAAGAACCAAAAAGATCTACAGAAGTGACTTGGCCTTGCCTATACTTGCATAAGTATAGTGCGAAATACGCAGA
TATAGCTCGGCCATTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAGCACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAGTCTCCTT
CACGCGCCAATACTGGCTTTGCCCAATTCTGATCGTCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGCCATAGGCAGTGCTCTATTACAAACAGATG
TCGATGGATGCGAACGCGTCATTGCATTCGAATATCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTGATGACAAAGAGATACTTGCTATGAAGTA
CGCTCTAGTCAAATTCAGAGTACATCTGCTTGGGTCCAAGCTATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTC
TCTCAGAGAATGGCTCGTTGGCTCTTATTGTTTGCCGAATATAACTTCGAAGTGAAGTACAAGTCAGGAAAGCAAAATTCTTTGGCTGATGCGCTATCGC
GCCGATCTGACTATGATCTTGCTCACGTCACTACGCTGTCATCTGCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTGT
GCTACGTGCTCTTGGAAGCGAGGCGTTTAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGACTACATCGATATTCTATCGATAATGGCCTG
TTGTGCTATCGCACGGATATTGAGGATAACCCTCGTTCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGATACCGCTTT
AAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGTTGGCCCAAACTATACAAGTGGGTGAGCAACTATGTGCGTACATAT
AAAGCGTGTTAACGAGTTAAACCCTCAGCACATGCGGCGGCGCCGCTGGCTAGTCTGCCTTTACCCACTGGGTGTTGGGAGTCCATAAGTATGGACTTTG
TGTTCGGCCTACCGAAAGATTCGGAGGCAACACTGGCATTGTGGTCTTTGTTGACCGACTGAGCAAGATGGCTCATCTAGCGGCAGTGCCGGACTCTATT
GATCCCGAAGGTACAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAGCATGGTTTGCCAGTGACCATTGTCTGTGATAGAGATCCCCGCTTCACTGGAA
AGTTTTGGAAGTCCATCTTCAAGGTTCTCGGCACCCGTCTGGATATGTCCGCAGCGGGTCATCCGCAGATCGATGGTCAAACTGAGCGTGTTAATCGCGT
CATTAATGACATTGTGCGCAGTGTTTGCGCTGATACGCCCAAGCGTTGGATCTCCATGCTCCCTGTTGTTGAGTTTGCGTTGAACAACGCTGTTCATGCC
TTTACAGGCTATATACTCCTTTCTACGTAAACGGTCTCACCCACCCTCTCGTTCTGTTAACGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGAGGT
TGCCGATCGGCTTGCTGATATCAGCCCTGCTACTATCCAAAAGCAGGTAGGTGAGTTTCTTGCAACGCGATTGATTGTCTTAAGACATGGGCGTGACGCA
ATGGCTGGGAGCCAAGACCAACAAAAACAACAAGCAGATGATAAAAACAGAGGTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGC