Description :
From Genome Similarity Track
Location :
Scaffold_2333:172- 3054
Sequence
2882 bases(100 bases per row)
GACCAAACTACCAGTTGCTGAGCTTGCACTCAAACAACGCCGTCAGGGCCAGGTTGAGTTCAGGGCCATTTCATTGATCGGTCTACCCCCCCCCCAGGGC
GCCTCCTCACTGTTGGAGGGGGCGCTGACTCCTCAATCCAAAGTGCGGGGAGTGGCCTCGAAAGCCCTTGCCTCCCAGGTCTTGGAATGTGAGACCCTGT
TTCGCTGCGGAAACAGGTGGAATCCTCTATGGATACCAAGCTGACATGTCAGCAGGGTCCGCGATGCCATGCCAGCGGCCCAAGATAAACAAAAGGAGTA
CTCAGACAAACATGGAAGAGGAAACTTAAGTATATTTGAGATTGGGGACTTAGTGTTGCTAGACACGAGGAACCTTCCTCTTGACACTGTCAGCTCTGTC
GGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGAAGACGC
ACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTCGACCCAGCTCCTCGAAGCGAGGGCCG
GTCACAGTCGTCGACGAGGTCGTTGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAAC
GGACCCCGGCGCCATACGCCGAGTACGCTGAGTACTCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGCTCCGGACGTGGCAACAAA
GCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCA
GGTCCAGGCGGCCCGCAAGGCGAGCGAGCTCGCCCTGATTCCTGGCCTGGGCGGCAGAATTACCGCCAGTCTCAAGGCCAAGTGCAATCTCAAGCACGAG
GACACGTTGATGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTAC
TCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAG
CTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCAAGAACTCGTGGGGCCTATTGAACGGCTCCTGATTGACTTTTCGAAGGCTGTCGCAATCTGGGAACA
GAAGCGGCGGCAGCTTCGTAAGTAGTCCGGGGCTTCTTGCCCAAACGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAG
CCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTG
ATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGACCTCCACGTGGGACAGTTCTCG
GGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTTAGGGGAATGCGGTGTGGCG
CGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACCAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCAC
AAGGCCACGAGGAGCGACGAGGACTTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGTGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTG
ACGGGTGCCGCCACCGATCCCCCACGCACACGCTGGGCAGCTTGAAATTCCTCTTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAG
CACCCTCCTCCTCTTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGG
AGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACCCGGCAAGCGAGAGACGTTTGCGAGGATT
CTCTTTCTCATCGCCACCGGCTTTGGGATCGTCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGAGGTCCTAGGACTGTGACCACCTTGATCACTA
GCGAGCGACTGCACGCTGTCATCTTTGTGCTCAGTGGGCACTGAGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCCCGGACTCGGCAT
CGTCCTCACTGCCTGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGATGATTGTCTAAAGATGAGGGCGACGGGCTGCGGCGCTTGCTTGCGCGCTT
GTCCACAGCCGCGTCACCCGAGGAACCAATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAATGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCC
TGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTAGACGAAGAGCG
CACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACG
AACACCTCTTCATTCTGATTATTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCC