Description :
From Genome Similarity Track
Location :
Scaffold_564:172- 1908
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_564-abinit-gene-0.15Myosin

Sequence
1736 bases(100 bases per row)
TCGAGTCCAACCCGCTGCTCGAGTCGTTTGGCAACGCAAAGACGCTGCGCAACGACAACTCGAGTCGCTTCGGCAAGTTCATTGAGATCCAGTTCGATCA
CCACGGCAAGATCGTCGGCGCCGAGATCATGAACTTTTTGCTCGAAAAGACGCGCATAGTGTCGCAGAGCATCGGCGAACGCAACTACCACATCTTCTAC
CAGGTGCGCCACTTACTGCAGCTGCTTGTTTGACTGACGCGTCGTCGTGCTCGCTCGATATATCTATCGTGTTGCTGACTGCTGGTATACCTTTGTGATG
GTGCTGTGTATGGTCTGCAGCTTCTCGCAGGCGCTGATGAAGAGCTGCGAGAGCGATTGCAGCTGACGACCCCGCACGACTACGAGTACCTCCGCAAGAG
TCAATGCTTTACGATCCATTCTACGTACGTATTTGTCGGATCAGCTTCACTGCTTTTGCTCGTTCATTAAGTTTGTTTGTGTTTTGCGATTGGCAGCAAT
GACGCGGAAGAGTTTGAAACGACCAAGCACTGCATGGCGACGATCGGTATCAACGAGGAGCGTCAAGAGCGAGTGTTTGACTTGCTTGCTGCTGTGTTGC
ATTTGGGCAACCTGAAGTTCGATGCGGAGAACGAAACGTGTGTCCCCGCTGGCGAAGAAGCTCACGAAGGTCTCCGACACGTTGCGAAGCTTCTCAAGGT
CAGTGAAGATGCGCTTCACAAGGCACTCTTGACTCGCCAGCTGTTCGTCGGTGGCAAAGTTATCGTGCAGCAGCAGAACGTTGACCAAGTCCGTGACAAG
CGTGACGCGCTGGCGAAAGCAGTGTACTCGTCTCTGTTCCTGTGGCTTGTTTCCGAGCTGAACCGAACCATCTCGCGACCTCAAGACAAGTGGGGATTCA
TCGGTGTGCTCGATATCTACGGCTTTGAGAAGTTCGAGTGGAACACGTTCGAGCAGCTCTGCATCAACTACGCGAACGAGAAGTTGCAGCGCCATTTCAA
CCAGCACATGCTTGAAGTGGAGCAAGAGGAGTATAGCAAGGAGGGCATCGACTGGAAGCACATCGACTTTCTCGACAACCAGCAGTGCTTGGATCTGATC
GAGAGCAAGCCAAGCGGGAAGCCTGGCATCTTCATCTCCCTCGATGACATCTGGCGACTGAAAGGAGAGGAGGCAAACAAGAAGTTCGTGTCGATCCTGC
ATGCCCAGTTTGGACGTGATCCGAACGGTTCCCAGTCGACGTTGAAGAACCAGCACGATTGGTACATCCATCCGAAGGTGGACGCGAGTCTGCACTTCGG
TATTAAGCACTACGCGGGCGAAGTCATCTACGACGCTAGTGGGTTCAACGACAAGAACAACGAGACCTTGAACGACGACATGAAGGAATTGATCAAGCAG
TCGGAAAGTGAGTGGGTTCGCAGCATCTTTGATCTGAACGTCCAGTCGATGGAAGCAATGCCAGGCAACAACGCCAAGCGCCCGACGGAAGCTGTCTCGC
GACGGCCAGCAGAGGCTGGAGCTGGCGGTGCTGGCAAATCTCGAAGCCTTCGTGAAGTTTCGGTTGGCGCACAGTTCCGTTTCCAGCTTCAGGAACTGAT
GAACAAGATCTCTCTGGCAAACCCAAGATATGTGCGCTGCATTAAGCCGAACGAGAACAAGCGCCCGGGCGAGCTAAACGACGCCGACTGCGCTCGCCAG
CTGAAGTACTCTGGTATGATGGAAGCGATCCAGATC