Description :
From Genome Similarity Track
Location :
Scaffold_4151:172- 1799
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4151-fgenesh-gene-0.0Glucose transporter

Sequence
1627 bases(100 bases per row)
TCTCATTCCTCTCTCTCACTCCTCAACTTGCGCGCTCCCGAGCCCAGCTCCTCCCAGCAACTGACGCCAAGAGTCCTCGAGTACAATCGCCAGCACCCAT
GGCGCCTTCCCCCAAGAACGACTCGGAGTTCCTCAAGCTCGAGTCGCCAGTCGCCGTGAACGGCCCGTCGACCCCTTCCTGCCAAGTGGACTACGTCGCG
GCCCACGATGAGACGCCGTCCAAGCCCAAGTTCGCCTTCTACGTGAGCATCCTGCTCTCGTTCTTCCACGCGTTCCAGAACGGCTGGGCCACGGGCCAAG
TCAACCTCAAGACGTACAACAACAAGCACACGTGCGCGGCCGACCCGATCGAGCCAGGCACGTGCGTCATGTTCCCGGGCCACACGACCACCGAGTGGAC
CTTCCTCACGAACGCCTGGATCGTCGGCGGCATGATCGGCACGCTCGTGTGCGCCATCCCCAACGACCGCCTCGGCCGCAGGCGCACGCTCTGGTTCAAC
GGCATCACGATGATCGTTGCCGGTATCATTGAGATGACGTCGCAGAACATCTGGCAGTTCGTCGTCGGCCGCTTCATCGCTGGTCTCGTCTCGGGGTTCG
CCACGGGCATCGTCGGCGGCTACGTGGCCGAGATCTCCCCGCCGCACCTGCGCAGTACCTTCGGCACGTGCTTCCACCTGTCGCTCACGACTGGTATCCT
CATCGTCGCCTGCACGTTCTTCTTCCTGGACACGAGCAACGGCTGGCGCTACTCTGCGGCGGTCCAGGTCGTGCTCGGTGGTGCGTTCATGCTACTGGCG
CCGGCCTTCATGGTCGAGAGTCCGGCGTGGCTGCTCTCCAAGGGCCGACACGAGGAGGCTGAGACGGAGATCGCGCGCCTGTACGGCAAGGAGAACGTGG
CCAAGGCGCTGAGCTGGATGCAGCCGGCGCGTGCCAACATGTCCAGCGCGTTCTACAGCAAGGACCTCGAGCAGGCCAAGAAGGAGGCCGCCGTCGAGAA
CAAGGGCATCTCCGCAATCTTCGAGCCGCAGTACCGCCGCCAGCTCATCATCGCGACCGCCATCTGCGGCTTCCACCAGGTCACGGGTATCAACGCCGTC
ATCTTCTACTCGTCGTCGATCTTCTCCACCGCGGGCATCAGCGACCCGCGCATCGGCACGCTCGTCGTCGACATCATGAACATGTTCCCGACGCTCGTGT
TCAGTCTCGTGGCCAAGCGCTTCGGGACGCGCAAGATGCTGCTCGGCGGCTCCTTCATCATGTTCGTGTGCGCGATCGTGATGACCTTCACGCTCATCTA
CGGTGCCAATGTGGCGTCGATCATCTTCACGGCCATCTACGTCGGCGCCTTTGGCGTGAGCTTCGGGCCGCTCGTGTGGTCCGTCACGGCCGAGCTCTTC
CCCGTCGAGGTGCGCGCGAGCGCCGTGTCACTCTGCATGAGCGTCATGTGGATCTGCAAGCTCATTGTCGGCGTCGGCTTCCCGTACATGAACGACTGGA
TCGAGAACTACTCGTTCGTGCCGTTCATCTGCACGCTCACCATCGCGTGGACCTTCATGTACTTTATGGTGCCGGAGACGACCAACAAGACGATCGACGA
GATCCAGCAGGAGTTCAAGGCGCTGCG