Description :
From Genome Similarity Track
Location :
Scaffold_678:172- 1757
Sequence
1585 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATTCACTCCTTCCTCCTAATCCACCATTCCCCTGTGGATTCGTATTCTCTTTCTTTCCGATGTGACCAACTCACATCAG
CGATCCTCCTCCTCCTGGCCCACACCCTTCCTGTGGATCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTCCCTACTCTTCT
TCATGAGACTGCATCATGCCGAATCTGTTACAATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAAC
TGGGTTCGTCATATCCACGCCAATACACCTGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCTTCTCGACTTC
GAACTCGTCGGCTTCGAGATCCACATTCCAACTGTCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGGTCGGATACATCCACCGAAAGACGGATCTGC
GGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGACACGTGTACTACAGGGAACATGCGATATTCAGTACCTGCCGTTTCCAGCTTTACCGCATGTT
CTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGA
TCCCACTTGGATTTTATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGC
CGGTTGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCTAGGGTGGATTTGGGAT
CCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCT
TTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGCTGCT
CGCTGTCGCTGCCCTAGGAACCGGTTGGATGAAAGCCCCAAAAGAAATCAGACATAAAGCCTGGCTCCCGAATCATGTTCTAAATCATTTTCGCTAGCCA
CACAATCCTTCGGAAAAACACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAACAGGTC
CACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATCTGGAAAGGGTAAGTCGCTCGGACATTC
CCAGGTGACTCCCCTTCGATCGTAGGTCTGCCCTTGCCTGTCTCACAATCCACACATTCACCGACATATCGTTGTACACTCTTGAATAGTCCTCTCCAAT
GGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGGTAGTGGTGTAGGACATC