Description :
From Genome Similarity Track
Location :
Scaffold_2068:172- 1722
Transcript NameFunction/comments
Phymu_g13856GK15001 putative
Phymu_g13857OSIGBa0134J07.9 putative

Sequence
1550 bases(100 bases per row)
TACTGGACGCGCATCCCCAGGAACTTGCTGACGCGACCCAAATTCTTGATCTCAAGCGTAGCTAGCGCGTCGAACAATGCGTCCACACGCTCATCGCTAG
TACCCGTAACAAGCAGGTCGTCGACGTATACGCCAACGACGGTCATTCCTGAGTCATCGGCCTTGAAGTACAGGCAAGTGTCCGTCGCGCACCGGGCGAA
GCCACTCAAGACGAGCTCGTCATGCAGTGTCTTGGCCCACAGGCGCCCGGCCTGCTTCAGTCCGTACAGACTACGACGGTGCCGCAGCACCATCCTGGTC
TGGTCGCTGACCCCATGCCCccgcatcttctcctcgtcgacGCGCATACCCTTCGGGACGTGCAGGTGAatgttcatgttcttctCAGCATCCGCCTTGA
CGTACGCGTTGGGGATATCACCGTACTTGGCTGGAACTCGCCATATCatcgccagcaccaggatCACCTTGGTGTTCGTCACGTCCATCACAGCCGAGAA
CGTCATGGTGTAGTCGACACCAAGAACTTGTTCGTTCCCACAAGCGACCAGGCGTACTTTGTAACGTTCCACTTTGCCGTCCGCATTCGTTTTGGTCTTG
AAGACCCATTTGGTGTGCAGTGGCCGCACATCGTCCTTCcgcgccaccagctcccaAGTATGGTTGGCCTCCAGCGAGTCAAGCTCAGAttccgctgctg
cgcgcCACTTGTTGTGATCGTGCGACTTCATAGCCGCGTTCCAGCTCTTGGGGTCCTCGCGATACACCGCACCAATGATCTCAGGTGGCGGTGTCTTCGC
TCCGCCGTAGCGCGTCACCATGGGATGCGTACTTCTGGTGCCATCCTATGCAGCAGGTACGCCGGTCGACTTGGCTCTGCTACCCCCGCGACTGCCACGC
TTACCGCGAGTTGCCTTGCCCGTTCTTGATGTGGCTGGCGGCGACTCGCTCGACTGCTCCTTCCGAAGGCCATGTCCGTCAGGTTGGCCATCGCCTGGTA
CATCCGCAGACAGCTCGACACTGTCTCGTTCAGCGGCCACGCCCGCGTCGGCTGCAAGGTCCGTCTCTAAGTGTCGCAGGAGCTGTGCTTTGTAGTATCA
CTTAGTGTCTGGATATTTTGCACGTGCTGTGTGGTGCGAACCACACGGTCCTTCGTGAACAGCACTCGGTAGCCCTTGGTTTCGTCATTCTTGCCGACTA
TCAGTCCCTCCtccgctcgtgctgcaagaGCACTCGGTTTCTTGTCGCGGATAGCCGTGCATGGCGACCCAAATACGACGATGTCGGTCGCCTTGGGCTT
CTGTCCAGTCAACATTTCGAGTGGAGACGCGCGGCCCGGGTTGCTTCGCGTCGGACTCCGATTCAGGATGTAGGCCGCGTACTCCGCTGCGTCCCCACAG
AAGCTCAAGGGGAGCTCGGAGCCAAAGAGCATGGAGCGAACCATGCCCATAATCGTCTGGTGCATGCGTTCGGCCTTCCCATTAGAAGCCTAGTTGTAGG
CTTCAGATACCTGACGTCGCACTCCAGCGTCCTTGCAGAACAGGTCCACA