Description :
From Genome Similarity Track
Location :
Scaffold_9:172- 1375
Sequence
1203 bases(100 bases per row)
CACGAGTTGTTGTTCCCAACGATGAAGGTTTACGTCATCGACTCTTGTATGAGTACCATGACAGTCCTTCGGGTGGCCATCTCGGACGTGAGAAAACGTT
TCTCAGTCTTTCCCGGGATTATTACTGGCCACACATGTACAAGTGGGTTCGCAAGTATGTGAGAACTTGCGAGATCTGCCAGCGTGTGAAGCCATCTGGC
TCCACGCAAGCCCCACTTCGTTCATTGGCTGTCCCATCGGACAGTTGGAAGTCTGTGAGTATGGATTTCATATTCGGACTTCCTCGTGACAAACACGGAC
GCAATGGCATCCTTGTGTTTGTGGACCGATTCAGTAAGATGGTCCATCTTGCACCGGTTTCGGACAAGATCTCAGCCGAAATGACGGCCAAGGTCTTTGT
AGACGTTGTTTTCCGTCTACATGGCCTACCAGTCGAGATCGTGTCTGACCGTGACACTCGTTTCACATCCAAGTTTTGGCGTGCACTGTTCAGACTTCTG
GACACCAAGTTGTCCATGTCAACAGCAGCACACCCGGAAACGGATGGTCAAACTGAACGAGTGAATCGTGTCCTGGAAGATGTATTGCGCAGCTATGCAA
CATCTTTCGGAGAGTGGAGCGAGTTTCTCCCTCTCGCTGAGTTTGCGTTGAACAACTCCACGCATGTCTCGACAGGTCACTCTCCATTTTATGTGAACTA
CGGCATTCATCCCCGAGTGCCTGCTTCCATAATGGGTGAGGTCTCTACCTTGAGTGGGGGAGGGACTACGGCTCTTGGAAATAAGCCGCAGTCAGTCACT
GACCTGAATGCTGTTGCCGAGTTGAAAGCCAATTTCGACTCGATGAAACCTCTAAACGACATGACAAGTCGTGAGGCACAGCAAGTCGACGACTTTATTG
TGAGAAGACAAGCCATTGTAAGGTTTGTTCGAGACGCAATTGCAAAAGCTCAGGATCTGCAAAAGAACAAGCAGATAAGAGTGGAGGAAGACAAGCAAGT
ATATAAGGTCAACGATCTTGTATTGCTTAGCACGGCTAATCTGCCTGAACATGCAGTGTCCAACTTGGGAAGTTCGAAACTTTTGCCAAGATATATTGGA
CCGTTCAGGGTAGTTAAATGCAATGATGATGCCTACACACTAGACATACCTACACGCATGCGTCTACATCCTACATTTTATGTGGGTAGACTAAAGCCTT
ACC