Description :
From Genome Similarity Track
Location :
scaffold_974:172- 1338
Sequence
1166 bases(100 bases per row)
TGATCACAGTATGTGTCAGTATTTCAGGTATGGTAGCTGCGAAGCTAAACAATGAACTTCATTTTTGCATTGATATCCTTCACCAAGTTTGTATAGTCGG
TTCACGCAGACTCCATAGCTCGCGGATCTCTCCAGGCATTGTGCTTGGTATACACCATCTATCTGCTGCTACGTACATGAGCTTGCTACACACTTGAAGG
GTGGTAAGATACTCCGTCGCATTATCTCCATTCAGATGAGTCAACTGCTGCAACAACGCAAGCAATCTCTCCCCCACCGTCGAAATTGTTTTTGCGCTAT
GAGCGCACGCAATCAATCCAAAAGGTAACAAATCAGTTGCGATGTCCCTACCAGCAAGTTTGGAGCATTGAATCTTCATCAGGTATTGTTCATGGATCAG
GGATGACTTCCACGATAAAGCACACGCCATGATAGTAAATAGTGCACGGCACTTGAAGAGATCCACCGGAACAGAAGAGTCTGCGGAAGACATGCCCCGA
CTGAAAGTATCGATCACGTCCAGAAGTGGAGAAACGGTTTCCCCAGGTCGTGTATGTTGAGCAATGAGGGAACCCATTTCGGCGATAAGGGGCTGCAAAT
ACGTATCGACAAGATTGATATCCGTCCATTCTTCAAAGTCGTGACGTAAAATCCACTGGAATGCTAGTGATGCCTCGCGCTTGGTGATGGACAAAACTTT
GAGTTTCGTTAGCTCGATGACGAAAATACCATTCCTCCACCAATTCCACATGGAAGAATTAGCCGCCATTGGTATCAAGAATGTGTCAGCAGCGCTGCGC
TCACCGTAGTCCACCTTCGAAAGTACACGAACCGCAAATTGCTTTACAAACCAAGAGGCATGTAGTCCGAATGGAAGCTCCTCAACCATTTTCTCAAGAA
TAACTTTGTTCACCATTTCCGATGAACTATCAGGAATACGACGAGTTGGTTTAGCTTCCAAGATATCGCTTAGCATTGTGGTCCAGCTGTCGAAGAGAAA
GACACTGCTACTGCTCGAGGTATCACGACGCCAAATATCTTTGAGAATGTCGAAGATTGTTGTAAGTAGAGTCCGCAGTATGTAAGTCGGAACGCGAGTA
GCTGCCTGTGAGATCCACTTGATTAGTTCAGCTTGAAGAACTGCGTCAGCATTTCCAAACCATCTG