Description :
From Genome Similarity Track
Location :
Scaffold_258:17198- 23157
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_258-snap-gene-0.10Titin isoform N2-B

Sequence
5959 bases(100 bases per row)
GCGGTCTTCCAGCCCTATGTCAAGGGCGGCGCGGGTTACTATGGCGATCCGCTGAACCCCGACCCCGAGCGCGTGAATGAAGGCGCGCCGTTCTCGCCCG
ATACGCCGCGAGTGTACCTCTTTGGATCGCCCAAGCGTGAGTGTTCTATTTGGTTATTGGTAACAGGGCTCTGCGGACTACTGACTCATAAAGTGACGTG
GATGCTGACGCCGCAGAGAACTGTCCGAGCATGGTCGGCCCTATTCAGGAGGAAGAGTACTATTGCCGTGGCCGCGAGTACGGATACTGCGACCATCGCA
GTGGCCTCTGTGTGTGCAATCAAGGGTACACCGGTCTGGACTGCACGGACTGTAAGCCGTCCTACTTCCGCAAGGGCAGTCTCTGCTACCCAAAGAGTAC
GAGGAGAGAGTAACCCTACTAACCCCACTCCCCCCACTAAGGTGTCGTTGCTGGTCTCTTCGTGCAGGGAGCTGTCCGAACGACTGTTCACGCGCCGGGA
TTTGCAACTACGAGACGGGCGCGTGCACTTGCGCGCTGAACCGAAGCGGCGACGATTGCACCAAACTCGTGTGCAGCTTCGACCCGAAGTGCACGAGCTG
CACGACGACGGCGTGCCTCAGCTGCCTCGAAGGCTTCTTCGTCGAACCGTCGACGCAGAAATGCGGTGCGTGTGCTCCTGCCTCTATGGACTGATTCAGT
GTGGGTGATGATACTCACGCTTCTCTGTCTTCCACCTATGCAGTCTCGTGCAAAACGTACGACCCGCGGTGCCTCGTGTGTGACAACGCACGGTGTCTCC
AGTGCGCCGATCCGATCCTCAACTCCATTCGCCGCAGCGGTGCCCGCAACGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCGGTC
GACGAGCTCACGCGTGAGTTCTCGTTCCAGTTCTCGTTCGGCAGTCAGGACCCGCGCGTGTTTGACGAGGCCGAAGTGTTTGAGCTGCTGCCCGTGACGG
TAACCACGTTTCTCAACGACGTCAGCGTGGCGTGCACGCAGGGCCTGCGGTCGGATGTGTCGTGGACGTGCCAACCGAACCGCGTGAGCCACCGCGTGTG
CGGCCACGCCGGCGTGTTCTCCTTCACATCCCCCGTCTACGCCGTGCCCGAATCTTCCCAGAGCATACTGCTCACCGTCCAGCGCAGCGGCGGTGGCATG
GGTGCTGCATCGGTCTCCTACGACATCCAGCACATTACGACCAGTGCACAGGACGTCTCGCCGACGGCCTTCTACACGAGCTCGCAGACGCTTCAGTTTG
CAAGCGGCGTCGTCAACATGTCTTTCCTCCTCACGATCCATGAGGATCGACAGATGGAACCAAGTGAGACCTTCCGCGTCGTGCTGCGCTCGCCCAGCGA
CGGCAGCTCGCTGGGCAACCAGCGCCACGCGGACGTCACGATCGTGGACAATGACGCACCCCTCACGGACGCGACGTTGACGTACGTGGTCCCTTCCAGC
GGCACTACGTTAGAAAAGGGCGGCGCTGCAGGGGACGCATTGTCGTTCCAGGTCCAGGCGGTGCTGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATCGGCCAAGAAAACGGGCGGCGATTTGCTGCTCATGGAGTCGTACGTCGTGGACGAGACCGAGTTTGAC
GCGCCTGCTTCTTCCCTCTATCGCTCCAAAGTGGTCGGCTCACTGACTGACTTCGCGAACGGCCTGTATAGCGCCGCGTGGCTGCGCCGACACGCTGGGA
CGTACACCGTTTCGGTCTACGTCCTCTATGCCGGCGGTCTCCTGGGTGACTACTACGCCGACGCCTGGCTCAGCGGCACTCCTGCCGTCTCCCGCGTCGA
TCGCCAGATTAGTTTCACGTGGAACGCGGGGTCGATTTTCCCCGGCGCGAGTGACTTTGTCGGCGTGCGATGGAGCGGACGGCTCCAACCGAAAGCCACG
GGCGACACGACCGTCTTCGTCGACTGTGACGATCACGTGCGGCTCTGGATCGGCGACACACTCCTCATCGATCGCTGGAGTCTGGAGAACGATGGCGGCG
TGCAGGCGCAAGCGACCATCTACTTGGACGCCACGCAGTTCTATGTGATCCAGATCGAGTACAGGGATCTTACAGGGGACGCCCGAATCGCTCTGAGCTG
GAGTGCGGCGGGTCTCCCGAAAGAGATCATCCCACCGTCGAGTCTGTATACTGCCCAGCATATCCGGGGCAGTCCTTTCGTAAATATCGTGATCTCGCCG
GCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCGCTCACGCTCCAGCTTTTCCCCG
TGGATGTCTACGGCAATGCCCGCAATGTTTTCGACGCCAAGCTCGACGCGTACCAGGCGACGTTGAGTCTCCTCACCGACCAGAGTCTCGGCGGCGTGGG
CAGCAAGACGGTCGACTGCGAGATCTCTTGGAGAAGCGAGCGAGCGCTCTTCACCGTCATGTGCGTGCCGTTCGTGAGCGGCGCCCACAACCTCAATGTC
TACGTGAATAGTCAACTCCTCGTGGGCAGTCCCTTTGCTGTTGCTGTGCAGCCGAACCGCATACACCCGGCGCGGTCTGTGCTCTCCGGGGCCGGTCTCA
CGCTCGGCCGCGTCGCTGGCACTGCCACGACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCGAGACCAGAGACCTCCACAACA
ACCGGATCTTCGCCAGCAGCGGACCCACGGTCCTGCTCACGGTGCGAGCGATCCACGCTACGCAAGCTGGCGTCGTCGACCTCGGATCCGTCGTCGACAA
TGGAGACGGCACGTATACGTTCACGTACACGCCGCGCCTCGCGGGTTCCTATTTGATCCACGCCACACAGAACGACGCGCCCATCCACAACGCGCCCTAC
AGCGTCACTGTCGTGCCAAATGTCGCTGTGGGCTTCACAAGTGTCGCCTCAGGGTCCGGACTGAGTGGTGTGACGACCAATATCCAGTCTGCCTTCCAGA
TCCAGTCGCGCGACGCCAACAGCAACGACCTCACGGCAGGCAGCGGCGCCGTCTACCAAGTGATCCTGGAACACCCGACCAAGGGCAACGTCACGGGCGT
CTGTACAGACCTGCTTACAAGCAAATACGCCTGTACGTACACGCCCAAGTACGTGGGTACCTCGAAACTCCACGTCGGTCTAGTTCGCGGTGCCGTCTTT
TCGCCTATCATCGGCTCGCCGTTTGCCGTCCCCGTGGTCGCCGGTCCAGCACTAGGCTCACTCAGCTTCGCCAGAGGTGGGGCCCTCGTCTCTTCGGTTG
CTGGTCAGCCCTCTAGCTTCACGGTCGTCGTGCGTGACGCCTTCAACAACGACAAGCAGAACGCTGGCACCGAGACGCTCAGCGTCGCATTCGTTGGGCC
GGCACCGTCTACCATGACCGTTCCCGTCGCCAATACTGGACTCGCGATCGTCTACAACGGCGACGGCACGTACTCGGTCTCGTACACGCTCACGACCAAA
GGTGCGTACAAACTCCAAGTCACCCTCAACGGCGTCGCGGTGCTGGGCAGTCCGTTTGCCATGTACACGTACCCGGCGTCGGCCTCCCACAAGACGACGA
CGATCGACTTGGTCTCTCCCACCGCGCCGCCGTACTATGCCGGTGCACCTATCGTCACCCGCATCACGACGAGAGATGCGTTTGGCAACGTGCTGGAATC
CGGCGGCTCGCTCTTCCTATTAGACACGGCACTTTCCAACGCATCTCTGATTGCTAATCCTCCTGCGCGGGTCGTGGATGAAGCCGCCGGCACGTACGTC
GTCCAGTTCACGCCGACCGCCGCCTTGCGTTACAACTTGGCTCCGCGGATTCTCTATCCTGGCGGGCTCAACGGAACGTACTATGGCAACCCCGACAGTG
TCGGGCCGGCTAAGCTCCAGCGAATCGATGCGACCGTGGACTGGGACTTTGGTGGCAGTGCGCCGGTCGAGACGGATGACCGCGAGACATTTAGCATTCG
ATGGGACGGGTTCGTGCTGCCCAAGTATAGTGAGCTGTACGCGATCTACGCGACTGTGACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCGCGA
GCTCTTCGGGTCGCTCTGGCCTAGTGCGACCAACGCACAGGCATACGAACAGATCTCGCTAGTCGCCAACCAGCTTGTCTCGCTCCGCGTGCACTTCTCC
AAGCCGAGGCTCTTTCGGAACGCGAGTGTTCGGCTGGAATGGGAAAGCCTCTCACAGCCACGGCAAGTGATCCCCTCGAGTCGGCTCTTCACGGCGTGGG
CATTTACGGACAACGTCCCACCGGTCAACGTCCTCCCAGACATCGCCAGCAGCGCGTCGTTCACGGCCGACTTCCCACGTGGCAGCCTCGCCGAGCCAAA
CACGGTGACGGCGACCGCAGGGAAGCCGCTTGTCTATTACGTGACTGCGCGCGACCGCTTTGGCAACCAGCGGCGCCAAGGCGGCGACCGCATCACCATT
CTGTTCCCGCAGCTTCCTGACGGCGCGGACATCGTTCCAGCAGTCGTGGACCTCGGCAACGCAGTGTACGAGATCACGATCCTGCCAACACTCCGCGGGG
CGTTTTCCATGGTCGTTGCAGCGACGCGGCTGAGCGACGATATCCACCCGGGCACGGGCACGGACTCGCTCGTAGAAAGACTGCGCCCTTTCTTTATTCG
GCAGAGCCCGTTTACACTGCGCGTGCTTCCGGACGCGCCACTCGCCACAGCATCGACGCTCGTCCCAGGCGAAGGCATCTCAAGCGCCATCGCTGGTGTC
GCTTCGTCGTTTGTCGTAGAGCTACGCGATCTCCATGGGAATCGCGTCCAGCAAACGATCCCCACCGAGAAGCTCCTTGTGAGACTGCGGCAGCTCGCCA
CACCCGCCGTCTATTATGACGGCGAGCACGGAGATGCCGTCAATGGCTATCTGCGAGTAAACTACACGGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAGTCTCGGGCGCGTACGAGATCCTACTGGCCGTACTAGACACTGGAAACCTCGTCCAGAAGACGGCGTCGCTGCAGGTGGTTCCGAACCTCGCGTCC
CCACTCACGTCCAGTGCGTCATCCGGCACGGGACTCGGCCCTCAAGTGCAAGCGAATACGCGTCTCTCGTTCCAACTCGACCTGCGGGACGCGTACGGGA
ATCCACTGGCCCGCGGCGGCAACGACTTAGTTGTGCTTCTGCGCGGACCCGCAGTCGTGNNNNNNNNNNNNNNNNNNNNNNNNATGGAGACGTTGTCGAT
CTGCAGAATGGCCAGTACCTGGTTCAGTACTCGCTCCCACTCCCAGGCACGTACGAGATGGAGACCACGCTCGCGAATCCTGGCGTTGGGCTGGTCGGGT
CGTACTTTGAGACCACGCGAGTTGCGATGACGCGAGCGATCCAATGGGTCGATCCGCGACTGGACTTTGACTGGCATGCGAACGAGACCATGCGCAATTA
TCCGCGCATCCAGTGGCACGGCTTTCTCAAGCCCTTGTACACGGAGACGTACACGCTGCGGCTGTCCGTGTTCCCCTTTGCGGCCGTGTACATTGACAAC
CAGTCAATCATCGACGCCATGAATGTGGATTCGATCACGGGGGACGCATCTGTGGACATGGAAGGGCGCGTGGAGTTGGTGGCCGGACGGCTCCACCGCA
TTGTCGTCGAGTACCGCAGTCCATCGCGGCGAGACGTGCGTGGGTCATTGAGATTACAATGGCGCAGTGCGAGACAACCCATGGAGATTATTCCCACCCA
GGCATTTCGCCCCGACGGCCAGGAGATCCCGCCGAGGTTCACCCTTGTCGCTGTGTGAG