Description :
From Genome Similarity Track
Location :
contig_179:17195- 18396
Transcript NameFunction/comments
g11408.t1necrosis inducing protein NPP8

Sequence
1201 bases(100 bases per row)
TCAACTACAACCAGCAACAAGTTCAGTCAACTTTGACCTTCTCCGCGACCAGTTCCTTCGTAAATGCTCAAAAGGTTAGATTGTACGGATGCATCCGGAT
AGCATGAGAAGTGAGCTGACTCAGGACAAAAAAAAACACAATGTATCGAGGAACAATCTTAAACCCCAGGAGTTATAGCAAAACCAGGACGTGACAAATA
AACTACAGTGTACTTTTGCAATGCATGCGCTTTACCCGGAATTCACAATACATGCACTCCTATTATTTTAATATCATCTTAAACTACACGTATTGGTTAG
CTTATTGGTTTCCAAAGCTGAGAGGGTTGAGCCATTTTGAAGACAGTACATGTATAATAGTCACAATAGTACATGTATTATAGGTATATGTACACACATC
TGCCACGTTGTAACCACATGCCAGGGTCTTTTGTGTGCCGGGCGCACAGCAAAGGTAGAGCGGGTGTCCTTGTATGCTTGCCTACTGTTTGTCTGCAATC
CGTCCTATCGTTAAGATGTGATTCGGAACACGACGAGATGTGCTGCTTGATGCGGTACATGTACGGTACTGTAGTACCCCACGAATCGTCAATGCATCAT
TGATAGCGTGCTCGAATTTTTAGAAAAGAGCAGTCTCTCACAGGACAGGTAAGATTAAAAATAATCTAAGATACTCTGAAATTAAACAATCACCAAACTT
TGGCACAAGCCGCTATTTTTCACAACTACATGTACTCGAGTTGGCCTCATTGTCCAGTACATGTACATGTATGTTTGACCCACCTTCCTTTGAACTACGA
CGTCACAGGTCACACAGATCACGGGAGTATATCGTATCGCATGCCTTGGTCTAACAGCATGATAACTTTTAATGATCGGGTGCAAGCTGTCTCTTTGTGT
CGGACCCTCAAATGAGTCGCCTTGACGACCCGGAGGGATAGCCTAACCTACTCTTTTTCTCCGCTCCATTCCGCAATTCTTCCACCGAGACGCGAATCAA
CAAGCTCCAGGTGTGGAGATGAAGACCCACGTCGTCCTCTGCGCCGCTTTGGCTGCCATTGCCGTCGTACAAGGCCAAGAAACGTCCAAGACGACTGTGA
AGTACATCGACTACTCGTCCTTGAAGAATTTAACGAGAGCTCCGACTGTGCAGCAAGACACGTCGGGGTCTCAGGACCAGCAGCAACAGCACAACAACAA
C