Description :
From Genome Similarity Track
Location :
Scaffold_1:17190- 19218
Transcript NameFunction/comments
Physo_127022hypothetical protein

Sequence
2028 bases(100 bases per row)
AGCGTGGAATTACACCGTCCAGCCGATCATCAAGTTCACTGGAGCAGTGCAACTTGAAACTCACCGCGTACCACGAGGTAGAACAGCAACACACGTATAA
CTTGAAATGATACTTTCCGGTGGGTTTTTGTGGGTTGAAGACTATAATGTGGCGGGCGTACTGGGATCGGCAGGCAATTGTGGCCTCATCAACAGCCACG
TTTCGACCGACTTCGACATGGCGCAGGCATCGCGATTTCAGAATGCTCATGAGTGGTCGTATTCTAGCTACAGGACCGCGCTTGATGTCGGAGGTAGACA
CCTTGGAACGAAAACTCAAATTCTTACGGATGTACAGGAATCTTCGCCATGTCATAATTGACTTCAAACTAGTAGTACGCGCTCCAGGAAAAAATAGTTG
CTTCCTCGTCGTCCACCCAGTAATTTCTCATCTCACCCTTGTCGTACAGAGTCATGTACCAGAGGATCCCATCCGGATGTGTAAATAGCCCTGACGGTTG
GCCAAGCGATGCTGTGGGTGAAAATGTCATTGACGCTATCTCTTCGACTTCACCAGGGCACAAAGGGCGCTGCAATTCTTTTCTGTCTTCGGGCCAAAGA
CCGGCTCCTCCTGTTCCTCCGTATTTTTGCTTCTTTTGCGGCCGCGCGCCCTATCTTTTTTTTGGTCTTGACATCAGCACTCTGGGTTCTTGTCTTCCGC
TTGTTACTTGTCGCCGCGCAGGACTCAGCGGCCAGATGTCTCTCCTTCATTGTCGCTGTCCGGGTAGTCTTTTTTGCTGCGCACATCTGCTCGACCTTCT
GGTTTCGGTTTGGCGCAGTTGGTAGAAATGAAAGGGGTCAGGACGGTAAAACACATATTAAGTTACGAGTTCGGTGACGTAAGGTACTATTCCCCGTTTG
CCCTGCCAAAACTGATTCATGGAAGTATCGACCGTTGGACAATCCATTTGCGCTGGCATCATTCAAGCATCGCAGCCAAGTGGCGTGAAACAATGGAGCG
CTGGGTGGATGCGCGGACACAAGCGATTGAGACGATCACAAACATCCTATGCAATAGAGCTTGGCCTCACGACAAGCTAGTGGTGCTCTTGCGAGGTCTC
CCTGGTAATGGAAAGACTACGTTCCGCGACCACTTAATTGAGGAACTTCGGCGAGCCATTGACTACGTGGATGCTGAAGAGGATTCGCCACGGCGCGTTC
GCTTCTGCAGCAGCCCCTTGTACCTAGGGTTGGCAATTCACGTTTAATTACCAGTTATTAACGGTTACATTCAGTTAAAAAGAATGTTCACACGTAATTC
ACAGCTGATGTTGTTCACGCTTAACGTTCAACCTCCGGGTCTTGTTCCGTCAAGCCTCCTTCTCGAACGAGTCAATCCACATCGCGTGGACTTCTCTGAG
AACTTCTCGGCGCAACGCGCCCTCACATGACTTTAAGTCATAAAGCCTTTTGGTCTTTCGACCGCAGACAGCCTCTCGCGAGATCGGCCTCGGAGCCTCG
CTCCGCTCGTGCTGCTGCACTGCGTGCCTCCGCGAACGCCAGCGCCCCGCGCGCACACCCTCGACGCCTTCCAGGCTCTCGGTGTCCGAGTACTTCGCGG
CGCAACGCCTGAAGCGCAGCTCGCAGCGCGCAAGCCCCAGCTCTCCTCAAGCACCAACCCGCCAGATCATGGATCCTAGAGAACTCTTTGGTGATGACGG
CGAGGTGGACGAGTCCATGGAGGATTGTCCGAACCGAGGAGATGCGTCCCCACTCACGCGACGCTCCCCTAGCCGCGGTGACGCTTTGCCCACACCGTAG
ACACGCCGTGAAGAAGGCTCGCCAGCCCCAGTTGGCTCTCCCAGCCATCGCGATCACGAGCGCCCCGCGCACATGTCTCCTGTGCGCTCGCCGAGCCGTC
CACCTGCAGAGCGCGCTGCGCCGTCGAGGGAGGAGCCGCGACCACCGCCGCGAACTCCGAACCCGTTCCCTGAACGCTCTTCAGGCCTCTAGGAGCTGCG
CGCGCTCACTGAGCCACGGTATTCGCCA