Description :
From Genome Similarity Track
Location :
Scaffold_1820:1719- 3126
Transcript NameFunction/comments
Phyag_g11549hypothetical protein PHYSODRAFT_525302

Sequence
1407 bases(100 bases per row)
CTTCACTTCCGAAATCGCCTCGTCCTGCGCAAAGCTCGTCTCGTCCCACAGCCAACTCGATGGAGTCCCCTAGCAAGTCGGAGAAGTTCGTTCAAGAAGA
GCCTCTCGAAATCGGGCGCGATGGCATGCCTCCGGAGATCTGGGACGACATGGTTCAGCACGAGAAGTTCATCTACTTCTCGCTCATGTTCCTCAACGGA
TCCGTGCTTTGGGCCTACTACTCGTGCCTCAGCGCCCAGGACTTTTACGTGGTCGAGTTCCCGGACTCCGGCCTCGACTTCTCCTTCCTGACAACCCTGT
GCACGGCCTGGCCCATGGTCATCGGTCAGGGGCTTCAGATGGTCTTCGGACTCGACAAGAAGTTTAGCCAACGCACCCGCGTGCACGTGGGCTACGGCAT
CTTCATGCTCATGGCCATCCTCATCATGATCTTCAGTGCCATCAACTTCTCCAACCAAAAGACGGGCGGCATCCTCGTGCTCGTGTGCTTCGGGTGCATC
GGGTTCGGCAATTCGCTGTCCGAAGCCACATACTACACGTTCGCCGCCCTCTTCCCGATCGAGAAATTCACCAACGGCGTACAGATCGGCAACACGTGCG
CCGGCATCCTCAACATCACAGTGGCCacggtgctgcgtctcgccGTAGGAGGCGTGAAccagaccagcagctccacgaagcTGAGCTTCTATCTGTTCTT
TAGTCTGTTGGTCGTTGTCCTCATTTGCGCCATCTTGCTGTACCGTTACTTGGTAAGTCTGCCGTCCGTCAAGTTCCTAATGGACCGCAACGAACTATCG
GCCAAGGAGGAACATCTAGCGAACCAGTCGGTCGGCCGTACACTCAAGAACCTGGGCcgcatcttcagcatcatctGGATCCCGGCCTTGGCGCAgttcc
tcatcttcttcgtgtcgCTCTCGGTGTTCCCGGGCTTCGGTTGCGCCGCGTCGAGGAACCTGGCCCCGCCgtacagcgacgaagaccaTACGCTCACGGC
GACCTGGTACTGCGCccccggcatcgtcggcAGCTACAATTACGGCGACTTCATCGGTCGGGTCTTGTGTACGGCTGCGGTGTACCGAGTGGTGACAATG
GGGTGGGCGTTCGGTCTCTCCATTCTGCGTCTGGCCTTCatcccgctgctgctcatgggcgTCGCTGGCACCTCGCTGTACGCGTTTCCGTACGGCAGCA
TGGGCGCGTtggccttcaacatcgtACTGAACCTGCTCATCGGCATCTCTACTGGTCTGCTGTCGACGGTCACCATGGGCGTGGCGCCGCGCATGTTGAA
GCCGGAGGACCGCGAATCGGGCGGCGCCGTCATGGTCTTCTTCCTATTCCTGGGCATCGCTGGCGGCTCCACGTTCGGCTTCCTCGTCAGCGACAATGGG
TGGCTCG