Description :
From Genome Similarity Track
Location :
Scaffold_37:171885- 173409
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13840serine/threonine protein phosphatase 2A
Phypa_INRA-310PPTG_13841ATP synthase subunit beta, mitochondrial

Sequence
1524 bases(100 bases per row)
TTTCTTGCACTCGTTTAACACACAACCGAGCCATTATCTGACGCTTAAATGTGTTGCTATCAGAGCGCAGCAGACGACGGAACAGCGTCAGCTCAAGTGG
GCAGCCTTAGAACACCGCTTGCAGGCGCAAGGACCGATGTGACAGAAGCGCGAGGGTCTCGTCGCTACTATCGATGACAAGTACACAAATAACGCGAGAT
AGTCACACCCGACTGCGCATTGCGAAGGGAAAGTTGAAGCGAGCGAAAGGATTCTGTTCGATCCGCAAATGGCCGGCACCCCAGACCGGCTTACACGTAG
ATAGGCAGCGGAGACGGATGCCCACTTGCAAGCCACTGCAATCTTTGCCGTTGTCGTGAGCGCTGCGTTTTACATGTTTCTCTTTTGCCTTTATTGCATT
CTTGGGTTCGGCTGGGAATCACATCGAACTCCGTTGTTTCTTATTGTAATGCCATGATAATGTTAAGCGAGTTATTGCTGCTAGTGCGTGGAAAGCTGCA
TACGGTTGTTCTGCTGCAAGTGCAGGGACCATTGACGACTGACGTAGCTCTCAGTCGCTTGCGGCAGACCTCTTTGACCCTCCCCCACCGGGTCATTTTC
AGCCGCACACGTTGCGGTCGACGCTCGGGTTGGTTGAAGGCACGAACGATACGGGTCGTCTGAAGACCCGGGTCTGACCCATGTCTTGTGCAACGGATCA
GGTCGCTTATAAAATGGCTTTGACAAGACAGCCAATCGCTGGCTGATATTTTATGATTATCCAATAATAGGGCGTCTTGTATCTTGGTGATAGCTGCAGT
GTGTTGTCCCGAAAAGGTTGTCACCCCCTCCCTCTCTAAAATGATGTCATACAAAACCCAAGTGACGTAGGGTGTGTGGTCCTCATTGGCTCCCCCTTCG
GGGGGCGATCCGCAGGTTTGCGGCCGCTTCATTTCCGCTTTCAGCCGCAGACGGGAGCAGTTCGACGAAGGAAAACATAGCAAACATGCTGTCTCGTGTG
GGTCTTACCGCCATGCGCGGCGCTCGCTCGATGGCGACGGACGCCAAGAAGGCCACGGGCTCGGTCGGCCAGATCACGCAGATCATTGGTGCCGTCGTTG
ACGTGCAGTTCAAGGACAACCTGCCGCCCATTCTTAACGCCCTGGAGATCAAGACCCAGGACAACACGCGCATCGTGCTCGAGGTCGCCCAGCACCTGGG
TGAGAACACGGTCCGTACCATCGCTATGGAGGGCACGGACGGTCTCGTGCGTGGCCAGGAGTGCGTCGACACGGGCAACCCCATCATGGTACGTTCTAAA
TCTAGATTGCGCTGCAGGTCATTTAGAAATCTGGATCAAAAATATTTATAGATGTCCGGATATTGTTGAATGTGTAGGTTCCCGTGGGTCCGGAGACGCT
TGGCCGTATCATGAACGTGATCGGTGAGTCTGTGGACGAGCGTGGCCCTATCAACGCCAAGCGTCACGCCCCCATCCACACGTCGGCTCCTCTGCTGACT
GAGCAGGGCTCTGGCGCTGAGATC