Description :
From Genome Similarity Track
Location :
Scaffold_188:17188- 18333
Transcript NameFunction/comments
Phyag_g3255conserved hypothetical protein

Sequence
1145 bases(100 bases per row)
CTCTCCACCGTAGTCCCATTCAAAATGAGCTAGTGGCCTGCTCCTTCGCTTTCGCTTCGCGACTCTCGGTCTAGCTCTTCTTAGAAAACTTCAGCACACA
GAATCGACTAAAGCTGAACCGGTTTAGGTAGCAACGGATGGGTCGTCACTACAGATCCATATCCTCCACAACAGTCGATGAAGGCTGCCGGTCGCCTTCT
GCAAATTGGAGCTTGGTCGGGTCTGTGCCGGCAGCTGTTCCTGCttgtagttgttgctgctgttgctgttgttgctgcatcgcAAATGCTGCGGCAGTCT
CCTGAGTGCCTACGTTCACTATAACCCACACCGGGTCACCAAAGAATCCTCCGGGGCAGTGCAGCCTCCAGCTACCAGCATAGGAACCCGGTTCTACCGG
CATGCACAGCGGAGCGTGAATGTCTATCCGCTGACCCGCTGTTGCGGCCACTTCAATCTGCTCCGGTCCTTGAAAACTCGTGCCCTGCGCAAACAGCAGA
CGCGTTCCAGGCGGCCACGCCTCACTTCCCGTGTTCACAAAACTCCATTGCTTCAAAAAGCAAACCACGCAAAAAAGTTAGCAACACGCAATAGCAATTT
CGCATTGATCAAAACATCTTCTCACCATATGAACGGGCGTCTCCGGAGCGAAGGGCGTGTTCTGCGAGGCCGACAGGTCGCTGATAAATTGCGCCTGGTA
CGAGGCGGAGTtgggctgctggtgttgctgctgcggctgtcTCGAGGCTGCGTCcccgtcgtcctccatgtccaGATCGTCTGCCATGTCCATCCCTTCC
ATGGGGTTCACCCGAGTACCCCCCGTGGCTTCCATCGTGGCCAAATAGTTGTTGGCCGCCGTCTCCACGTTCCAGTTGCACGACtcgaggaagaaggtgg
cTGTGTGTACGTCCAGCTGCAACAAATGCGCGAACTggtccaccagctcgtcgtggtcgctggtggtgatgctcTGGAacatctgcagcaggtcgtcggC
CATGGTTTCTCTCTCTTTCCAAGTGGCGTTTAGAGACTCTGGAGAAGAGCGAAGAAAATCAGAGAAAACGCCGCGGGTTAGCTTTTTATCAGGAATTTTT
ACGCTTCCAGTGGGGTCATTGGCTGCGAGAAAGCGACGTACAAGT