Description :
From Genome Similarity Track
Location :
Scaffold_25:171856- 173177
Transcript NameFunction/comments
Phyra_77528alpha,alpha-trehalose-phosphate synthase

Sequence
1321 bases(100 bases per row)
CGTATGCGGTGGTAGTCATTAGGCCTTGAATCGAGTGTGATACCGATTTGTACAAGAACGACAGAGCCACGCTTTTCCGGGTGTGTCGCTAAGAAGCGGT
CAAATGCACGCAGCTTCAATGGGATAGCTGTGAGGCCTTCCAAGCGGTCCACAGACCCAATGATAATTGGACGCTGTTCATGGTCTCGTCCCGCCATAAT
CGTGTCCCCAATGTTTTTTGCGAACTTTAGCGCAGTTTCGTTCACATCAGCTTCATTCTGGTCCAGCATCTCATGCAAGTGCGTCACATCCGGCTCCACA
TGAGAGCAGGAGATGTGAATCTTGCGTCCATTGTACTCGATGACGAGCATGCCGTTTGGGCACGTTTTGTAGTCCAGTCCCAACAATCGCTTACAGCTTG
TAAGAAAGTGTCTCGCGTGCTCAAAGATGAGAAACCCAATGTGGTCCGCGCACAGCATCGCACGAAGGATCTCCGTACGCATCGCAAGACACCGGAATAT
CTCGCTCGAAGGGAACGGCACGTGCAGGTACATCGTGACCAACGCCATACGCAGACGACGCAGCAAGTACGACGGCACCATCAAGAAGTGGAAGTCGTGG
AGCCACACCAGATCACCACCATGGTAGCTCTCCACCACGCGTCGCGCGAACGTCCTGCACTCCTCACATAAAAGTTTAGCCACAAATTCACCACACCCAC
TATTAGTGAGACACTACCTGTTCACACTGCAGTAGTCTGCCCAGCACATGTCCTGCGCCGCCGGGTTCCACGACACGGGGTCGCACCACGTACTCTTGAC
GCCGCTGGTTTCTTCCTCCCTCCCTCCGAACCACCACTGATTAGCCTTGCTCTTCTCCTCCTCGCAGTCCAATTGCAGCTCCGCCGAGTTGTACACGTCC
ACGACGTTGTGGAAGACCGGCCAGAGCACACCCTTGCAGAAACCCTGGAAGTAGCGGTGCGCCACAGGCGGGTCCAGGAACACGGGGACGCAACGCAGCG
CCAGCAGCTGCTTCTCCAGCGCCGCCTCCTCGCTCTTGGCCACGAAGACCTCCGGGCACCCGATGAAGAGCGGCGAGTATTGGTCGGCGTCCCTGACTAG
GGTCCGGTAGAGCATGGCGGTGGCGCTGGTGGCCCACGAGACGCCCCAGCCACTGGCAGACGCCGCGCTGCGCTCAAAGACCAACGGCAGCACATTCACC
ACGATGAGGACGGTCTTGGGTGGCGCCAAGGCCGGTGGAGGCGACGGCATCTTGCGTGCGCTCGAGGCGACGGATTTTGGAATGGCTACTTACGTTGAAG
TTATAAATTGTTTAACTTGGC