Description :
From Genome Similarity Track
Location :
Scaffold_3:171831- 175803
Sequence
3972 bases(100 bases per row)
CCGGATACTGCTTGGCCGGCGATCGCTGCGTCTCTCAATCGACCTCGATTCCGCTATAGGAAGCGGCAAGCAACTCAGGAAAGGAAGGAACACACCCGGA
AAGGCAACTACAGGCCTTGGATCTACTCCAGGCCGACCGATCGAAGCGAAGAACCCTCGATCGGAGCGTATACTCGGACGCAGAGCGAAGACTACCGCGC
TGCTCCACAAACTATCCCCGCGTCACGCCAAGACACTCGATCTTCACCAAGTGCTGCATCTTCGGAGCCCTGAGAGAGCAGATCCAGCCCGCCGACGGGT
ACACAAGGTGAGAACAAGTTCAGCCGATCACGGATCGTAGGGGGACCCCCTCCGTTAGTCGGTGTCCGGGCGCTGGTGGGAAGCTCGATCAGGCCTTAAC
CAGATTTTGGCCGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTCTTGGGGTCTCCGGATTTCACCGTGAGTCCGTAGAAGATGCGCAAGTGAC
GAAAGAACCAGGGGAAGAGGCGCCGTCGGATATCGGATCGACGAAGACACTGCTGAACAAAACGAGATCCGCGGATCGATAGAGTGCTCGGAGGACTTCT
GTCGACGGAATCGAGGGCGATCAGGAGACAGATCTAGAAGACAAACCTCAACATCCTCCCCAGGCCCCTTCGGGGACCCCGGTGGATCTTGGTGCGAACC
GAGATTCACTAACAAAACAAACTAAGGCGGGATCGGACCGATACGCGTTCGCTGACTCGCCGATCAGGCTCGATCCGGGCTACCTGGACGCGATCGCGGA
CAAGACCCAGATCGTGAGGAAGAAGCTGAGAGCGCCAGGCGTGGACGACGAAGATCCCAGACCGTCGGCGCTCGACTGGTCTGAGGCTGACCTGGATCGT
CAGTATTACTTGAAGGAACTGCGAGATTTCTTGCGTCAAGATCCTGTCATGGTGATCGTGCGGCCAGAGCAGATCGACGACCCGAAGGGCCCGATTTCGG
CCCCCCGAGTGACGGATAACAAGCTGATGGCGGTGAAGAACCTGTTCGGGCTGTTGAAGGAAGCCGGCTTCGTGGCTGGCGCCTTTGAAGCGAGCGATCT
TTTCGATCAAGATCTCGATGTGATCCAGACAGCGATCCAGACATTGGTCGACAAGTTGAGACCTTTGGTCGACATGATCGCGGACAGTCCGGACCCGACG
GTGCCATATCCAGTGTCGCCGGCTCCAGTGTCATCGCTGCTAGTGGAGTCGACTGGGTACCGATCGTCGTCACCTTATGTCTCCGCAGCGGAGCATGTAT
CGGATACGTCGTCTGAACCCCAACGGATGTCCCTCGGCCCTTCAGGATCTGCGATGTTGGACGCGCGATCACGGAGTCAACGTCAGGAACGCATGCGGTC
AGGACCTCGGAAGCAGAAACCCAAGTTGACCGATCGGACCACTAGTGCCACCGGATCAGATGAGTCGAATGGCAGACTGGAGTCTTACTTTCAGGCTGCG
ATGACTCGATTTCTGAAGGAACAACAGGCCACGGTGGTAACACCTACTCCAGTGGTCGACGACAACGTTGGATCGCGGGACGTGGAGATGGAATCAGCCG
GATCATCGGACCAAGACCCCTCCCAGTGGGAATACGATCCGGACGATACTGATCTACCCAGTTCGGCCCCTGCTGTGGTGGCCATTGTTACCACGGAATA
CACTGGGTCCTCCTTGATCCAGCGCGTGCGAATCTCCGCGATGTCCGATCTCAAGGAGTTCAGTGGCAATGATCAGGACGAAGATCGCGCCCGATCGTAG
ATCAGCAAGGTGAAATCGGCGTTCCTGCGAGATCAGGCTACGGACGAAGAGAAGTGCTTGACCTTCGCTGATCTAATGACGGGCCCGGCGAAGATCTGGT
ACCGCCAGCTGGGCCGATCGACGCGGAACAAGTGGAGCGATCTACTCCGGAATTTCCAGATCCAGTATTGTGGCCTGGGAGTATCGGTCGCTTGGCAGTA
TTATCATTCTCGCAAGAGATCGGATGTATCGCCGTTGGAGTACCTCTATCGACTGAATGTGGCGGTTCTACGTGCAAGATTGAAGATCAAGGACGGGGAT
TCCAAGGCCCGCCGATAATATGTCGAACACGTTATCGAGACACTGGGCGATCCGGAGCTGGCCGATCGGCTCACTCTACTCCGGCTTGCGGACGTGGAAG
ATCTGGAGGAAGTCCTGCGCGCTCGAAAGCGCGAAGAGTAGACAGAAGCGATCCGCCTTTGGACCGAAGTATCGTCAGAAAGTTCCGACCTCAGCACCAG
CTGCTGCAACCAAGCGGGCAGTGCGTGCAGTGCAGATCGCGAGCCAGGGGTCTGGATCGGACACGGGATCAGACGGATCGGACTCGGAGGGTGATCTACG
TCGCGTTTACCTAGCGTCGGCCGAAGACAAGTCCCGCAACGCTGGGGGCGACGCGACGAAGCCGGATCGAAGCAACCAGGCGCAGATCAACCATGACCCA
CCTCGATCGGATCCACGATCGCGATCTTCACGTGACGGATCGGAGCGATCAAACCGCCGCTCACATTGTGGATCGCGGAAACACACCGATCTCGATTGTT
GGAGACGTTTGACGTGCGAGAAGTGTGGCAAGAGAGGTCATCCGGCGGATCGCTGCCTGTTTGTGTGCCGTGGACGTGGTGAACTACACGAGATGGGCAT
ATGTCCGATGGAGGAATTCTACAACCAGATCCGTCAATGGTTCAACCCGTGAAGCACGCTGGCATGTTGCCCGCGATCGCCGAGAAGATGTTAAACTAGG
ACGCTCGCCGGGTTGGAATCCGGTACGTGCCGAGCGTTCTAGGTACTACATCTATGCATTCGTGAACAAAAACACGGTAGATCGAGTAAGTGGACGGACT
GATCTACGCGGTAATACATGTGATCTGCATGCGAAATTTGCCGCCAAGGTCTTAAGTCGTTCTGACGCCGAAGTGCCCTTGGATCTCCAGTCTGGAGAAA
CGCGGGGCTATTGGAAGCAACGCAGACCGGAGGAATGGTTCAAGCCAGCTGATGGAGAAGTGACGACCGAGATCCCGGAGCATGATCGCGATCGAAGTCG
GCGTCGCGTCAGCGAAAACCGCAGATCTGGCGATGTGGTGCCCGATCTCCTCCCTGGGGAGTCCAGAGGGTACTGGAAACATCATTCGCTAGGTAAGTGG
TTCCGTCAGGCCAAGATCACTGGCAAGATCAACAATGAGAAGTCGATCTTACTCTTAGACACCGGCGCCGAGGTGTCCATCGTGGACACCGCCTTTGCTC
GTAAGGTGGGGTGCTATGTCGACACAAGTCAGAGCCAGGAATGTGTGGGGATTGGCGAAAGCGTGTACATGACGGAAGGAAGGACCAGGATCAAGGTTAC
GCTGGCGGGATCGCTGGTGTATTTCTTCGATATCTGGGTTGGCGATCTATCAGGACAAGAGACGATCCTGGGTATGGACTTCATGGTTCCGGCGGGGATC
CGCATCGATCTTGCGGACGGCTCTACCTGTCTCCCCGACGAAGTCAAGATCCAGCTTAGCGGACGGCGCCAGCTGTACAACGACAATGTCAGACACGTGT
GTGTGTGGATCAGGGAATGCAGATCGCGATCGGGGATTCGATCGAGCTTCCGCTACGAATGAATGTGACAGATCGAGAAAAGCTATGGGTCACCCGTGGA
GATCGCTGGGTGCCGACTGTGGTCCGAGGACCCGGCAGGATCAGATATCTCCAGGTTACCAACATCAGCGACAAAGACCTCGTCTTGCATCGGAATCAGC
GGATCGCGATGTGGCTGGCTGGAGATCGGATACCCCGGACCCCAGGATATGTGTCGGTCGGATCTCGCCGATACGTGGAATGGCAGAATCTAGCCTTTCA
AGCCACGACAGATGACCGGCCGACGAACCAGGAGGTACCAGCGGGACCTCCAGCACCTGCCGTCGAACGACC