Description :
From Genome Similarity Track
Location :
Scaffold_10:171801- 188342
Transcript NameFunction/comments
Phymu_g822endo-1,3(4)-beta-glucanase, putative
Phymu_g823hypothetical protein
Phymu_g824hypothetical protein PHYSODRAFT_469149
Phymu_g825hypothetical protein PHYSODRAFT_294124
Phymu_g826hypothetical protein PHYSODRAFT_322268

Sequence
16541 bases(100 bases per row)
ATTCACCCACAAAAAATGAGACAAAAGCAGATTATCCGGATATTTATAATAAAATTCAGTCAATTCTTTTTTCCGGACAAACTCAGAAAATCTTTTCATT
TTCGAATCCGCCACATATCCCTCGAGTCTCCGGTAACAACGGGGTATCTCCTTCGACATGTCGTATTCATTGTTCCCGCCTGCACCGCCCAATGCACCAC
CGTCATCTGCTGCTCCCCCACCGCCAGTTTTCCGGTCAACGAGCGACTTGAAGAGGCTCATTTCGCCCCATTTCCTGTCTCCAGATGCGCAGCAGAGGCC
TATTCCGACCAACGAGTGGTGGGGCAACTTGTTGGCGTGGGACGGACAGAAAGACAGTGACGCTGTGTTTGCCGGCCCTTACACGTACAAGGTGGTGCCG
AGCCAACCCGGATCCACTGGCAGCGGCCTCTCGGTTAGCTACTTGATGCAGTACCGGTCGGACGGCCCAATCAACGACAACGGAGCCCCGCGTTTCTACT
TCTACCCGCCGACAATTAAGAACTGGATCTTCTCGGCTGTGGAGCTTGCAGATCAATCTGGTCCTCCGCCCCTTAGCATCCAAGCTTGGGATGATATGGG
AGTGCATTTGTCCATGGCTGGGATGAGAATGTACTTGGCTTTGGGATCAGCATTCACAACGGTGGAGTACCAGGACATGCAGGTGCAACTCGGTACGGAG
CATTGCATTGTGGCTATTAATGGGGCTCCTGCGAGAGATGGTCACCAGGTGAATGGCATTAGCTTCGTGGTGTCCCTGAACAACGGACAACAGTGGGTGC
TCTatttcttctccagtgctggTGGCAATACCTCGTTGgtgttcaaggacaacaAGCTCACGACCACTTCAAAGTTCACGGGTGTTGTTCAAGCAGCTTT
TGTTTCGTCCAGCGCAGTGCAATCTTCGGTGCCACAGGATGAGCACAAGATCCTGCAACTTTACCACGCCAGTGCTGGTGTTTACCCAAGAGGGGCTTCG
GTCCAGACACTGGATTCGGAGTCGTTTGTTTTCAATTGGCAACTTGTGAGTGCACCGGGAAGTAACTCCGGAGCTCGTTTCCTGCACTTCGCACTGACCC
ATCTGCAAGGAATGCTGGATCCCTCCACTGTCGAAGCCAAACACGAGCTCATGCTGCACTCGCACACGCACGGCCCGCTGTTTGCGTACATGTTGACAAC
TCCATCCAATTCCAATCCAGCGTGGCTTTGTCATGTGCCTCAGGCTGAAAGCCAGGGGGTGGAAATGTGTACAGCATTTTACCCTCCTCGTGCTGGGAGC
CTCACGAGAGATGTGGTTGACAGGCTCAACTTGTGTCAAGTTGTCGCTGACGAAATCCATGGGGACTGGTCTCTTCCGCATGAAGGCAGCTACTACTTCA
AGGgcaaggcgctgcagaagttcGGTACGATGTGTCTTGTGGCTCGCCAGCTTGCAGACACCACCAACCCGGAGATGCGAGATGTGGCGCAGCACGGCAT
caacaagttgcagcagttgctgtcgCAATTTGCAGACAACCAGTCGGCGTTCCCTCTTGTCTACGATACTGTGTACAAGGGGATCATCTCAAGCGAGGCT
TTGGCTCGGAATGACATGAATGTGGACTTTGGTAATGGCGTGTACAACGACCACCACTACCACTACGGCTACATTGTAATGGCGGCTGCGATTGCGCTGT
ACTTGGATCCGAATTGGCGCCATTCTGCAGATGCCGTTAAGCTTCGAACAATCGTGGATACTCTCATCCGGGATGTGGCAACGCCATCTCCTATCGGCAG
CGACCCGTACTTCCCACGCTTCCGATACTACAACTGGTGGTTGGGCCACTCGTACTCACACGGCGTGACCCCGATGGCCGATGGGAAGGACGAGGAGTCG
ACGTCAGAAGAAGTCAATTTCCTCTATGGTATTGCGATGTACGGTCAAGTGACGGAAAATGCAGAGCAACAGGCTCTGGCGAAACTCATGCTTAAGGTGT
ACGTGCGTGCTGTCAACACCTATTTCTTGCTGCGTAATGACGGCCCTGCTATCCATCCCGCCAATTTCGCCAAGAACAAAGTCACAGGAGTCTTCTTTGA
CAACAAATGTGACTACACGACCTGGTTTAGCCCCAACAAGGAGTGCATCCATGGCATTCAAATGATCCCAGTATCTCCGATTCTGGAAGTGTCCCGGCCG
CCACGCTTCGTTCGTGAGGAATGGGATGAAGTGTTGAGCCGACTTCCCATCGTGCATGACTGGAGAGCGAACCAGTCTGgctggacgtcgctgctgtttg
cCAACTACAGTGTTCTTGACCGTGAAAAGGCGTTCGAAGTACTCTCTACTTGCCCCATGGACGACGGACTCAGTCGCGCCTGGGCGCTATACTACGCTGC
CACTCGACCGCCACCTTCGTGCTAAGTGAAAGCTCTCAACAGTTCGTACTTCAAGTTGAAAACACTTCTCAATCCGTCTTCAAAAATGTCGAGCTGTATT
TCTTCCTGTTTTTCACGGAGTCATTGCTTCTAGGAGTGACTGCGCCAGCTCGGTTACGACAGGTGACACTTGTCGATCGCGCACGACGATCAAACACCTG
GGACATTGTTATTGGAGCACTGCAAGTTAGAGCCCACGTTGTCTGCTAAGTTGAGATGTTTATCGTACCTGTCGATGAGCTTTTGTAGTTCTGTTGGTGG
CAAAGTTCCAATGAATCCCGGAATATTCCCAATGATGGTCCCAATGACTTTTAGTCCATTCATGGCAACAGATTcacttcgtgctgcagctagATGAGCA
GTTGTAGCCTCAAAGCAGGTTCGAACGAGTTGGAGATCGTCATTATCTCCCATCGAGATCAACTCGTTAGCTTTGCGCAAGAACAGGAAAATAATCTGCA
ACAGTAATGGTCACCGATCAGCCAGATCGCAACAGTATATCAGTAAAACCGTCGTACCTGGAGACCACCGGCAACAACGTCCTGGTTAGAGCACTGTTCA
GTGGCTAGTGCAATCCGCGTGATGACTCCCTGTGTTTTCCAACCTGCGAGTACCATGCTCTCAGATCGCGTGATGGCACTACAGCAGACATTCGGTTAGT
GGGGGCCTGGGTAAGGCATGGGACACACTGCGCATCATTACTCACTGGAGAAGAAtattgcagcagcaaatgcgaACTTGCAGTGGTAACTGGTCGAAGC
GAGCTTCACTCCACATTCcttcgagcagttcctgAACCCGTGAGTCAATGGCTCCAGCATCGTGTTCTTTGGCGTTGCTTCCTCCGTTCTTGGTGGCAAA
TATCCAGATCATCAAAAGGTTCATCAGTGATGCAGCAGGTCCCGACTCCTTCGGACTGCTATTGCTTGCTGCAAGTCTGGTGAGAATCATTGCAATGCAG
TCAATGCAACCACGTTGGAGGTCGGTGAGGAGAGCTTCCTCCGAGTTTTGAATGGACGGAATTCCCAACACTTGAACCAGCAGAACAAGGACTTTTGACG
TGATACCGCAATCTTGGTAGGCATTTTCGTCCTCTGAAAAGACCCGATTGAGGTAATATACCATCAACTTCGCCGTCACTAAGCCACAGGAACCCGGAAC
GTTGCCGTCTTCGACAATAGACGAACTATCTCGTTTGTTGTATGGGGTAGCTTCGCGCAGGAAAGCAATCAGATATCCAAACACGAGCGGCAGCACAAGG
GCTGGAGGGAATTTCGCTAGGCACTCTGTGGCCAACATCTTGACCTCCTTGAATTCCAGTGGATCAACTACTGAGAGGGTTAGAACGTGGAAGAAAATCT
CGCTCGTTGTGCCCATTTCAATTTCAGAGCTTGCTTGCGGAGAACTGCagtagagctgctgctgacagtCAAGATATGTACTCAAGTGATCCAGATCCTC
ACATCCACACTACACATCCACATAAGGACTGTAAGTGATAAAACAGAATAGGAAATAGTGTGCTACAGATCTACGTACCGGAAATGACTGCAGTCGATTG
AGTCCAAACACGTTTCGGGGGAACATtcgaagcaccagcaacggaGCTAAACGAGAAAATAGCAGCCCTTCAATTGCTGTAGCAGCTGAAGGTGAATTGT
CGTCCAAGATGTCTTCACTCAACCGGGGTACAGTCTGTAGTGGCCAACACAATACTTAGAAGTATTCCCATAGTTCAGTATGGGCAACCCTTACCATCAT
GTGAGTGCAGATTTGTTTCCCCAACGTTTGGAAGACTTCGTCGTTTATCCAGCCACACGCCACAAACTCGCGCAGCATTCGCAAAAGTGCTGGGTCTCGA
GGAGAACCAAATACTTTTCGAATTAGTATGTGAAGAACCTCGCTTCTAGCATCCGTCGCTTGAATATGCTTGCTCCATCTGCGCGTAAACGAAATGAATC
AACACTATCAGGGTGGAAAGCTTTCATTCAGCCATTGCATTGGTGTTGTAACGTACCCAGCTGGGCCGAAGCACAACGACAGCATTTTTTCTTGGGGTTG
TTTGTCATCCAGTGCAATGGTTTCACGATGACTTGTGGCCAATTGGATTGCGCCGTCACTCCATTCCTGAGGAGATTCCGGGGTCTTGCTTGACATCGCA
TGGACAAGCACACTACCAAACTGGACAGTATCAATGAACCAAGACGCCATCATTTCAAGGGAATTCTTGGTCGAAGTCACAAAAAGGAGTCCAAGTGCCG
ATGTGAGAACGCGGTTTTCGGATGCATCAACGCCAGCTGCGGTCAATCGGCGCAAGCAGGACGTCGCATCCAGTGATGGCAAGCACGATATAGCCTAGAG
AAAAATGATAGGCATATATCTTCATTAGAAAACCAAACCATTGTATGCACAAGTATCTAAAACTGACCTGTCGGCAAACATAGTAGTTGTCGTGGGTTAT
ACAGTCTAGTACTGCCGGTGTCAGCAGCGTGCTGTTCATAATAATAAAAGCGCCATGACTTCAGCAATGTCCGTCAAAGAAAAAGCAATGTGAAACCTTA
CCGCCAGTATCGATGCAGTTGTGATTGTGCTGGCAAACTGTCGAGTTGATAGAGAAGTGTCCGAACGAGCGAAATTGAAGTCTAACCAATCACCACAGCA
TTTCATAAGGTCATACTTCGAAGAACTTTCCAGACATATCTGGAATACTCAACTTACCAAGTCACAGTGAGTGCGTATATCGCGCACCTGCTGTACAAGC
TCTGTGATGAATAGGCCTCGAGAAATGATGAAGTCGGCTACGAACAACTCCACTTCGGTTTGAGCGTGCAAAACACTACCGGAATTCTCCCGAGTGGTCC
AGGCGCTACGGTGTATATGAAGTAACTGCGACAGGagttcttgttcttcatctcTTGAGCTTAAGAGATGAAATGCATCGCTGGGCACCAAAAGAGCTCT
TAACACTTGCAAAACAAGGAGGACTGACGCGGTGTTGCCATCGTTGGATGCTGTAGATAAACCCTTCACAAACAGGAATACAAAAGACGCCTTGGTTTCC
ACGTTAAAGTCAGCAAAGGCCTTGGAACATCCTTTCACTCCACCAAACGCATCCATCAGTACGCACACATAGCGCAGCCGAGCGTAAATCTCCTCGGAAT
TGATATTGGAACTGCTCAACTTGGAGTTCTCATTTGTCCTGAATGCATCAAAGGCCAACTTTGTCATAACCCGAGCGAGAAATTCAGCCGACTCCTTTTG
AATTCGAGACGACGCGTCGCTACGTGTGCAAAACATCGAGGCGGTTGCCTCCCATTGCCAGCACAGCACACCCAACGCCACTCGGACATGTACATCCAGG
TCACGAGTGTCACCTTTATCTGCAACCAAACTGGACAAGAGACTTTCACAAGCTCCGACATACGTctgcaaatgctgcagagCGTATCCAAGAAACTGTC
GACGTTTAGAGTGCGAATGCCACTGCCGCAAAGATACCAGAAAGAAGAGCATACTCTCCACCGCTTCACGCATCAATCCATTATGAACCAGATCGCTCTT
AGCTGTTTCACTCGAAGCCATGTACTGCACCGCAACTTCGCCACACAATAACGCAAGCGTTTCCAAAGCAATCAGGGCAAGTTTCGATGGCTTGACACGA
TACGACGCAGCAACCTGGACTGTTCCTCTTTCTGCAACATGTCGTAGTGCATCCATGAACACTCCAGCTCGATCACCAAACAGGAACAAGCTCTCGGTTC
GGGTTTTCTCCTTTAGCATGCGATGATGTCGCTGCAGTAACTCAAAAATCGTTAGACAGGCAGCCAACTGGTTCTGCTTTTCGGCCGTCGGATGAAtcca
ctcgagcagcaactGCCGCACGTAGTCAACCGATTTATCTGCACTGGATCCACACTCATGACTCATCATCCAGTCAAGCAGAACGTGCAGCTTGTCCGCC
TGTGGGCCCCAAATGCAACAATTGGTCCGAGACGCAGTGCAATCTCTCATGGACAGCATCATGGCCGATCCAGCCACTGTACAGACCAAATTCCGCTTCG
AATCtacttctccagcttcattcACTCCATTTCGAATGTCGTACGCATCAGCGACTGTAGCCAAAGCCGCTTGTAGTCGTGCAATTCGTTTGTGGtcgga
cagcgacagcacTCGGCCCTGGGCAGCAAAAATGTTAGCAATTAGTAGCAATGCGCAACACTGAATAGCAGTAGATAATAAAATACGTTAGCGGTGTGTT
TCAGCTCGCCTGCGTCCCCGTCGGAAGGTTTAATCAAAGGCTCCGATCTGATTCTGACGCGGTCTAGACTTGTTATTGCTGCCTCCATCTACGTAACCAC
AGCATGCCAGAAGGCCACAGCTATATAATGAGGTAGAACAAGCAATaaggaagaagatggaagttacgtggaagagcttgcaGTCCTCCAGAACGCGTAG
CAGCCGCCCCACGCTGTCCCTATCTCTCGCCCGCGCCATTTTTCATGCAATGCAATAAATTTCACAACAAATGAATGGTGTGCGACACacaatcttcttc
tttttcattCTCAAAATTTTGCTATTTTTCTTattaagaaaaaaaaagaatcGTTTCTTCTTAATAAGTACCAACTCCATTATACATACAGATACTCCTA
GAGCTGGTGGCTTCCTGTCTCTCGGAAGCATGCGGTTCTGCTACGACTTCAAAGCGTCAATGTATTAGggtggtcgtggtcgtggcgcACTTTGTCCACG
TCGTAGTACGACGAACTGTCGTCGGAATGAGCGCTCAGGAACGATTGATTGGACGATTGGTTCGAAGAGCCTGTGCCTCGTCGGTGAGTGGGGTAATATC
TGccgtcatcgctgctgttgtcggtCATTTGGCTTTGCGCGTTGAAATCCACGCGAGATGTTGCGAAATGAGCCACTGACTGGTGTCCGTACGAGTCCAT
AGAGTCGCGATTGAAAGCGGATTTGGTCACACCGAGCGGTCCGAGCTCATAGCTCTGGCTTTCCACGTCGTTGTGGTCACTGCTGTCCGTGCTGACCACA
GTCTTGGATCGCTTCTTGAACCAACCGCTGCTGTCACCGTCAAAGCTGTTCTCCGAATCGTTCGAGAAGATAGACATCTTCGCCTGAGGACTGCTACCAT
AGCCACCGTTGTTGCTCGTTTTCGGAGCAGCCATAGCGGCTGAGAACGTGTTGTCCTGCTGGACGGTACTCTGCGTCATAGCCATTTGACTGCTGGTTGA
GGATACCACCGAGTCCGAGAAATTCACGTACGACTGCTCCATCATAGCGTACGAACTGGCCGATGAAGCAGCCGGGTTGAAATGATGACCCACAGTCGAT
GCACCAGGGTTAAACGGCTGACGGGCTGTCGGTGCAGCAGGCTCAGCAGTAAAGCCGTCGATATCTACGTCATCAATGTCCACATCTGTACGCAGCGCAT
CCATATCGAAACTGCGTTTCCTCCGAGAAGACGTAGTACTTACGCCTGAGCTTGTGCCGGAGAAGCTCCCAACATACGCGTCGAGCGGCACCGTCGAAGG
ACGCGAGCCCAGACCCGATCCTGACAtgccagcgacagcagctcccCCTCTCGATGAAGGCGGGCCTCTTGAGGACGCTAGGCCTCTAGTAGAGTTTTGT
CCCCGAGATGAATTCTGCCCCCGAGATGAATTCTGCCCCCTTGATGAAAGCTGGCCTCTGGAAGACTGACCCCTGGACGATTGACCTCTTCCGGACTTGG
GTGACATGGAGTATCCAGCTTCATCAGTGGTTTTGTTCGTACCGAGGTAGGCAGCCAATACATCGTACGTCGGAACTTCTTGCGCTGGTTCAGGAGtagg
agcaggagcaggagcaggatctggtgctgcgtTATTCACTTCGAAGGCAGCTGCATCTCGTGAAGAGCCTCCAAAGGAATACTGTTGGTTACGAGACACG
GGGGGCCGGATCTTGCCTCGAGAGCGGCTGAAGACTGGGACGGGCTCTGGGGCAGGTTCGAGCATGGGCACATTCTCAGACTGGCCGCTGCGGGAGCTCT
GCGTGGTGCTGTAGCCGGACATAGTGCTCGTCTGCGAttgatactgctgctgctgctgagttTGTTGgttgtgttgctgctcttgaagctgcttgttcgC
GTACCAATCTACCCCACGGCctgctggcgtcgtctcTACCTGCTCGTAAGCTTGACGGTTGGTGGACATGTCGTTTCCAGACTCGAGATTAATGTCAGTG
GCATCCAGACGGGAATTGTccttgccgttcttcttgtgtcGACAAACAACGACCATCTTGTGAATGATCGTGAAAGCCTGAcgcacgaacagcacgaaga
agatgaagataTTCACGCCGATGATGCCGTAGGCCACGTTGTCGCGCACATTCTGCGGGAAGTAGTCGTCTCTAGCCACGATAAGCATGAGGCAGATAAG
CACCACCTTCATGAACACCGAAATGATACCGAGGTAGTACAGGAAGCGCAATAAGTTTGGCTGGCGGATCAGCAGTAAAATCAAGTAAACCATCGTGATA
GCCAGGATACAGAGCAATTGCGTCGTGGCATCTCTCACAACCCCAACAATAGCACCAGTCATGACGGCCAGCAGTATCCGaggcacgaagaagaagcggt
tgTCGAAGTTGTACTCGTCGTAGTAGGCGCTgtacttgctgctgaacggACGCTGGTCATGCTCGTACGTTCCGACGTCCTTCAGTTCATCAGCATTGTT
ACCAACGACAATGAtgccaagcccaagagcCAGGAgcacagcagctgcaagtgcaACGATTCCCAGTGCGAAACGCGAACTGGAACCATTGGCCGAGTCA
TTCGACGATCCTTCCGAGACGAAAAAACTGCCAGCCATAGCGAACATGTACTGCGCCAGTAGTAGAGCCAGCACCCCAGCCCAGACCACTTTGCGGTACC
ATTTGCGAGCAACGTCACCGAACGATTCGTTCTTGGCTAGAGAGCCCAtcaccagcacgaccaaGAGATACAACACGTGAAGCGCTGCAATCACCACAAC
GAACGTCACGAGCGTGTAGAAGAATAGATCGTCGGCATCCACGCCAATGAGGGCGGCATATCTCGCCGGTCCGGACTCCCCAGCCGCAGCCACAACCCCC
GTCGCGCTAGAACTGGAGTCTGCCAGTCTTCGATCACCCCCACTCCCGCTGGAATCGTCACTGCTGCCCTTAATCAAGTTGAAATTCGTCCACGAGAGCT
CCTTGGAGAACTGCAGTAGAAACGTTGGCGCGCCTTCAATCCTCAACTGGCTGATCATGCCAGCAAACTGGGCCTGTTCCACAATGTGGGTCATCTCGTA
GAAGCCAGCAGAGAAACTGAGCGCTGCGGCGGCACTAGGCACCACAGAAGCCCACAGCATGGAGCCTCCTCCAATCACGGCTGCACCGGCCAAGGACGTG
GCAATGACCCCCGACGCGGTGCTTCCGGCTTTGGAGTCTAGGAAGTGCAGTGTGCCCGTGGTGTTGGTGGGCCATTGCGTATTGCTGCCGAAGACGCAGC
CGGAGCAACTGTTGCTCTCGATGTAGCTGGTGTTTAGACTGCCAATGTCCACGTCGGACGCGAGCCCCAGCGTCTGACGGATCTGGTCCTCGCCCCACGG
GATCGCGTACGTGTAGAAGAGTAGGCCTAGCGCGGCCAAAATGCcaagaggcagcagcagcgcgcagAGCTGCGAGAGCGCCATGCATCCGCAGCACTTG
GCGGCGCAGCACAGCAGCCCCATGCTTCTTAACGGTTATTAGGCGTACGAGGCGGAGGcggagctcgtggtggtggaccTGCTGAAGCGGAACTGGCTTT
GATTCGCGTGGGCTTTGACTTTGACGCGCTTGCAAGACGATGCAGAGGCGGCGGACGTAGAAAACAGAGGGGAAAACGCACCATCGAGCTTTGGATGGGA
ATGCGGCGAAAAGACCGAGCTCCGAACGCGGTGGTGATTGGCGGAAATGCTGGAATTAGTATCGGTTTGGAAAGGCTTACGAAGTTTGGACCAATCTGCT
GCATGAGAAAAATAGCCAGAAGCTTTTTCGGTGTCACTTTCGATTTGGGTGGGTGTGAGACGGGCTTGGCCGCCAAGTTGGCGGGCTTTTTGACAGGGTC
TCCACGGAGTGTCGATTCTCATCAGACAGCCATCCCGACGACAGCTACGATACATGTAATAAAGCagtgtacactgtacagGTATCATACCTGAGGTATG
CACATCCACTGCTACTTCGCAGTAACGTTAGCCAAGATTTTATGGCCATAGCATGCTCGAGCTCCTGGTGCGGTGTTTCGGTACCTTTGATGACAACTCT
GTCGGCTTGCGATTTCGGAGTTGTATGTCCGcgctactacatgtactttgcCGCACTTTACATTTGCAAACAACGCACCACTTTCGCCTTGTACCATAAG
TATTGTACCCAGGCCCGGAGCTTCGTATATACAAGAATAACGCCCTCAGGCCGCTTGGCCCTTAGTTTTCAGGGAGATTTTAGCTGGTTTTGGCCGATTT
TTTGGCCTCAAATCACCCCCCTCCCCTGGCTCCCTCAACATGCTAGCCCCTTCTAAAAATTCGCTTTGGCTCCGGCCTGACTGTACCATTGGATTGAGGC
GACGATCAGGTATCGAGCGTCTTCGTTAAATACTTGCCAACGTCATTACGGATGCCTCGCCGAtgttgcaacagcaacgtgtACGGTATGCCGGACAAAA
AATTACGGAATTACAAATTATGTAATCCACACGACATTGAGTCCAAACAATTatacgtgtacatgtatacctGAATAGAATATATAGTCCGAGATTTATT
ATTGTGGTGGACTATTTTAAAGTTATTTTTTCAATTGTATGGTGTGCACTACATACTATATTCCGTGTTTCGTACATCACCAAAATCAAAACCAAAATCG
ACGCCATGACCAGCGCAACGCACCCATACGAATGGTACGCGTGCCGCCGCCTCTAGGATGGCAGTCTTGCAAGAATGAGGCATTACACTGACCACTTTGT
ACTCACACATATTGCACTACTTGTAGCGAGGTCAGCTTGCACTTCCCAGAGGAAGTGGATGCgcagttcgtgctgcagacgcttgaggttgacgaggagc
tgcagcccgAGAAGATTCACCGCTCGCTCACCATCAAGGGCACGGAGCTCCATATGTACGTATACCTACTTCAGCTGGGTGTTTGATGTCATCTATATAT
TGGCGTTaacgctggtggtgcttgtTTCCTGCTGATTGAATGGTACTGGGGCGATGTAGCCACTTCGAGGCCACGGAGATCCGACTGCTGCGTGCTGCAG
TGTCTTCCTTCTACGACATGAGTGTGCTGACCGCCAGGACGCTGCTGGAATTCAAGGAGTGAGCCAATTGACAAATACACACGCTTTTTAACTTGGCGCA
TTCCCCAGTAGCCGAGTTCTACTCTCTAGGAGCAAGTCTAGCGTGGCCCAGCCAGTCTGGATGCGATCAGAGAGGCCACGTATAACTGGTGGAGACTCTT
TGATGATAAAATCTCACTGAGAAGATTCACCACAGAGTTGTCTGAGAGGACGATGGAACATTTGGCCTGCATGATACCAGTACGGAGACGCCATTCCGAT
TCATTCATGCGGTTGGAATAATGTACTTGGTTTGCCTTTGACATGGTCGGTCGATTCACACCCTGGTCTTGTTGATTCTTATGGAGAGACTCTCATACAT
TGCAAGCTTTTGAGTTTCCACTAGTCGTAGTCGACAAGCACTTTACGTGTGAAGACAGTGAAAGCGAAAAAGAACTGGTGGTGGTTCATCGATACAGCTT
CGCCATTCGCTAACCACGTACAGGTTTCTAAAGGGACTCAAACGCGTCAACCTCGTTCAAATGCATTTACAACTGAGACGCTGCCATGAGGTAGGCAttc
tcgctgttgcttttgctgcttgctcgTGTCGGCGTCGACGGTGCTTTGCATCGGTGTGGTCTCTGTACTGCTAGTCTCACCGTCGACCATAGACAACTCC
AAACGCGCGCGGTTGTCACTGCAAGTGAGTGCTTTGCTTTGCAAGCGTCGGTGGTATTCCGACCTTAACGTTATTGCGATTTTGCCAAAGGGTTCACCGT
AACGTTATTGCGATTTGCCAAAGGGTTCACCGTTAGCAAAGCGGGACGCTTCATTTCTCCGGCCTCAAAGCCACCAGTGAACCCACGGGAGCCCGCAACC
AACGGCTGCAAGTCAGAAGTCGTATAGTACCACCGCCGCGGCTCAGCCTGAAGTGGGGACTGGAATACCAGCTCAGCTGGCAACCATCGGCATTCGAGAG
CTGCGCAAGGTTTAATAGGGCAGGCTACTGTCTGTCGTCCTCAGGCGATCGGCTGGTGTGGACACTCATAGCGTCACTTTGGGCGGCCCAGCGTCGTCTG
TTAAGTCGACGATGTAGTGTGCACCTTTGAACCTTCGAGATTCACTAACCTCAGAACAAGAAGCAAGCTATATCCAGGTTAACCCACCTGGCATCCCATG
CGTTTTTTTCGCCTGGGAACTGTTGGCGTACAGTTATAATATCTACAGGCAGCGGAAAAGTGCAACTCGAGCTTTTTGACTTGAGGCCAAGCAGCCGGCG
TTTCTCTGAAGCGGCTGTGTGTAACATGCAACTTGTCGGCAACTTGTGTCACCGAGACAACAAGTGCCAAGTGCAAAGCATCGACGGCTGTCCAGCTTTG
CTGGTTTCTGATCGGTCAAGTGCTGTGCCCAACGCTCTCTGTCCCTCTCCTGCTTATCCCCGTGGCGGACTCATCCTTGTCGTTGGGGTTAGCGTGGCAT
TCACCAATTTGCACTCCCGTCCACACGTCGGTGTCAACTTCCAGGCAGGCTCCAATTAGCAATGCCCGATCTCCGTCTGGAAGACTTGGCCATTGACCCG
CGCCAGCTCGTAGAGCGCCACGTGAACGCCTCATTCGCGCACCACTCCGTGTCCTTTGACGGATCGCTCGGCCGTTCACACAACAAGTCACAGCGGACAC
GCAACTCGATGCCCGCAGCAGTGCAGCGCCTGTCGTCGGACCTCGGATCCTCGCGCCTCTCgagcttcggcttcatccCCGGCCACGAAGTCCTCGAGAC
CAGCGTCCGCTTCGTGGGCGTCTCCCGCGTACACAACCACTGCTCTTtcaagctgcacgtggaTACTGGCAAGGAGCAAttcgtgctgcagaagcgctaC
TCGCAGTTCCGCGATTTAAGgaagcaattgctgctggacacgaAGGTCTCGGATGCTTCCACTGGAAAGGGACGGCAGAGTGACTGCCGTAATGGAGCGT
GCATCGCGTTGGTTCAAGAGCTCGCAACCCTCAAGTTTCCTCGACGTAAGATGAAGTTCAAAATGCACAAGGACGATGACATCCGGACTGCAAGGGATCG
GCAGACTCAACTCCAACATTTTGTAGAGGTTCTTTTGGCAGTGTACCGCACGGCACCAAAGCGTAAGgtgcgctgctgcgtcaacTCCCAGTGCCGCGTG
CTGAAAGCTATCCGAGCCTTCTTGGATATCAAGGATCTAGGCGAAGACGAGCTTGAGGACTGGAAGTCGCTCAGCAACGGCACAACCAGCGGAGAGGAAG
TGCCTATTCTTGATACTCCACCATCGACGACATCGAACCCGTCGCTTCTCAGTAAGGCAGTGAATGATACTGGTTCGACCCAGTCGTCTACTGAACGAAG
GACGTCGGCGATGTGCCTTGAAGACCTCTACACAATCAGCGAAGACCTGGAAAACCTCCACGTCTAGACGATGTGGTACGGCGTACGGACGATTGCTAGT
CCTTACGTCTCGTATAGCGGCCAGCCAATGTacgtgtaccggtagtaaCTTATTGCGTAGTCAAGTACTTTAGTTCTCTTGAGGCAACTCGCTGGCGTTG
CCGAACCCCGCTCCATCCAAAAAATTAGGAAGATGCAGCAAACTAATTAAAAATTTGCATTTGATCACAAACTGCAAGTGTTCAAGATCCTTTTGTCTTG
AAAAGCTCCACAATGACATTCGAGActttgtcgtcgtcgttgcgTAGCCCTCCCATGATCTGTGAAGCTTTACCCCACTGGACGTTGCTACCAAGCGCCT
GCAAAGAGTCACGTGTTACAAGTTGGCCGTTAAGCGGATGCTATGGAGTGTCGACAGGGTTGCTAGCAGATTCACCAGTTACCTGTTCATGCTTGTTGTC
AGCGCTATCCGGACTCGAATTGTCGTTTCCGGCTCGCTCTCGGGCCCACTACGTTTTTTTGTTATCAGAAACCAAAAAGCGTTAGCCGTTCAATTACAAA
TGAGCCCACCTCATGAGGCACTTACACTGAGCCAACTGCCATCAGTTCCACGATAACGACGTGGAGACGGCTTGGGGTTGTCATTGAGTGGTTTCTGCGC
TCTACGGAGCTGGCCGGAAGAGACGCCTGGAACTCCATGCTCTGCTTGAGAAATTTGAGCAGCTCTAGGTGAAGTCTGTAGCTTTGGTAAACAAAAATCT
GGTTCACGTGATCGATAACCACCGAGATCTGGCCGAGGTCCCATGATGGGAacgtgttcttcttcatgccTAGTGAGCACCGAGGCCACCAATTCGTGTT
TGTACTGGTTCCATGTCGCTTCCCGCTTCAAGTCCCGCAAAACGCTCCTAGTGTCGGCGCGAGCCGAAAGCCCAAGAACTTCCTGGCGCAGCATTTGCTC
TGTAGTCGCGTCCTTTAGTATAAGTTGTCGGAAGTCTACACGGTCGACACGATACAGGACAGCAGTAGGCGAAGAAATCAGTACGGAAAACACTGCGTTG
GTCACACCTAGGATAGCTTCGTAGAAGCCGAAATAGTGCTGGCTTTTCCAAACAGTGAACACTGTCAGTGCTGCAAATTGTATGGCAAAACATTCCTTTT
ACCTGCAAATTGTGGACATTTCAACGAAGCAAGGCTGCTTGCGGTCGTGTTGCATTGTTCTCTGCTCGAGCACTGAATAGCGCTTGACCAGTCTACATTC
GCCCTGTTTTATGAAGTAGAAATAGTCTGCACACAGAGTGAGGATAATACCAATCATATCGAAACAACAGGCATCGGCCTTACTTGCAGGTTCGCCTTCA
ACAACGATAGCATCGTTGTAAGTgtgctggatcttctccattcgGTCGCATAGCTTCAGGATGCCTTCGTCTTCCCAATGATCCAAGCACGCCACACCTG
CTAGGAACGTCATTTTCTCCCTGCAGTTCCACAACAACTACAGTGTAACTAGCAAAATAGGATCACTGGTACTGAAAGATCAATACGTACCGGAGTTCGC
GTGATAGATTGCACGCACGTAGCGCCATGAACGTATCCCGATCAATCTGCATGAGCAATGTCGTCTCTGTGGCCACAACCGAAGCTGtccgttgctgctc
ttcaagaagCAAACCGACGTCGCCAAAGACCTCCAACGGCTTCATGGTTCGGACAACGTAAGTAGCATCGTGTGACATATCCAGCTTCCCGCCTGGATTC
AGGAAACTCGAGTGCACGCGGGCACGATTCATGAtctcctcgaactcgttcagGGTGGGGGCTGCCATGCGCGAGAAGTCCATCACCACGCTCATCGTCC
CGTACATGATGCAGTAAAAGGCATCGGCGCGGTCGCCTATTCGGAACAgagcgtctccgtcgtcgaGCTCGATGCCTTTGGCCGCTTTCAAGAAGCGCAG
TCGGTCTCTGGGCGGCAGATCGCGAAAGTATTTGACTCGTTGGACTAGAACAAGCAATTGATTCAACTCAGCATCAAATGCAGTACTGCGACCTAGTAGA
ACTCACTGTATTTATCAAGAAACTCGTAGTCAGCTTTGCATCTTGCCACCTCGGACAACTGCAGAATCCGTCTCAAATTGGCCTGCACTTCCGGCAGCTC
ATGGTTAAGCTGTTCTCGCCAGCTCACCCTCTTCGACAGCCTGACAAGAACCAATGCATTGAATTGGCGCTTCAAAACTACCCACATTGCACCCAGACGT
ACATGCTTGAAGTCTTTTCGGCTATGGCCAACCATTTCTAA