Description :
From Genome Similarity Track
Location :
Scaffold_3503:1718- 3021
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3503-snap-gene-0.2Polyprotein

Sequence
1303 bases(100 bases per row)
CTGGTGGACGAGGCGATCAAGAAGGGTTTTCCCCTGGAGAGCCGCAAGAAGCTGCGCGTTGCATGCCACATGTACGACATTTGGAGATTGGCGCTGGGTG
ATGACCCACCGGCCAAGGTGGAACCTCTGACGGTGAGGTTGAAGCCCAACACAGCGCCATACAAGTGTCGAGCGCGCACATACAGCCCTGAGAAGTTCAA
GTTTCTCGAGGATTTCAACCCCGAGCTCGCTGCACTTGGCTGGGTATTCGAGAACGGCCAAAGTCGATGGGCTTGCCCAGCCATGCCGGTGCGCAAGCCG
CACAGCAGCGAATTCAAGCAGACGAGTGACTACCGCCCAGTGAACGAGCTGACCGAAACGATTGCAGGCGTCATGCCGAACCTGCAAGTGGCGTTAGAGC
ACTGCAAAGGGAAGAAATTCTACGCGGTGTTCGACTTCCTCAAGAGCTTTTGGCAGCTGCCGCTGGCCAAGGAGAGCCAAGAGGTATTGATCTACATGAC
GGACAAGAAAGTCTTCACCTCCACGCGCGTTCCCCAGGGCTGCATGGACGCGGCCTTGCACTTCCAGGCAACGGTGGAAAANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGTGTTCGAGCGGCTCGACAAGCACGGGCTGAAGCTCAAC
CCCAAGAAGAGCCAGCTCTTCCTCACCAAGGTGAAGTGGTGCGACCGAGTGATAGGTGCAGAAAGGATTGGCCGTGATCCTGGGCGAATCGAGGCCCTGC
GTGAGATCCCGTATCCGAAGAACGCGGCAGAGTTGCAGCAGTTTGTCTGTGCGATGAACTGGCTACGCGAAGGGCTGATCAACTATGCGAGGGTCGTGAA
TCCGTTGCAGAAGAGGCTGGAGAGCGAGTCAAGAGCAAGAAGCGGACGAAGGCGATAGCAGCGAAGATCCCGATGGAGCATGTCGCTGAGGAGCGTGAGG
CCTTTGACGAGGTCAAGCGACTGCTGCTGCAGTCCGCGGTGCTCACGTACCCACCGCCGGGTCGCCAGATGTGCCTGCTTTCAGACGCCTCAGACACAGG
CTG