Description :
From Genome Similarity Track
Location :
Scaffold_32:171782- 173515
Transcript NameFunction/comments
Physo_134482hypothetical protein
Physo_134483hypothetical protein

Sequence
1733 bases(100 bases per row)
GCCTCCAGCGTCGTCAAGGAGTTCTGCTTCCGAGGACGCTTCGCGGAGGCCATCGAGGCGTACGCGTCGCTGCCGTTGACGGACGCGGTCCGTCGGGATG
TCGTGGCCATTCTGCAGGACTATGAGCAGTACCCGTCGCTGCTGTATCTCTACGAGGTGCATCGCTCCATGGGAAGCGGGGTGCAGCCGCTGGACGTCGC
GGCGGAGCTTGACGCACTGAAGAAGGTTGGGCGGACAGAGGAGATGGACACGCGCTTCCAGGAGCTGCCGGCCAAGGAGCAGAGTCGCGCTGACATCCAG
GAGCTTATGGGCAATTGAGGAGGTGAATAGAGAGCTCATGGCCCTCGTTCGTGTCTTGCACAAATGAATGAACTCACACAGTGTTCCTCGTTACCTCGTT
TCTAGAACTCAAAATCGCCAATGCCTAGGCTATCGACACTACAGTATTCCGCAAGTAGGCCGATGCTCCCTTCAACCGGTCTTCACCGCATACTACCTAC
TACTTACTGGAGAAGCTCACAGGACAGCGCTGTTGCTGTTGGTCGCGGTCATGAGCACCGAGTGGTCGGTGCCCATGACAGGCGTCTTGCTGTCCATGTC
GTCGAAAGCCTGCTTCTTCTTGCGAATAGCCACGATGGCGGCCACAGCAACGGCACCCACGGCAGCGCCGATGGCCAGCACGATGTAGGCAGTGCCTCCA
GAGCCGCCACCCGACGACTGCGTGTTCGCCTGCTCCACCTCGCCGTTGTTGTCGTTCGTCTTCAGAGTCGAAGGCGTGGTCTTCATGGTTGTGCCCGCCT
TCTGGTAAGGGGTGGGCTCGGTCGTGGAAGACGCGCTGTTGGACGCGTGGCTGGCCTCGCTGTTCGACTTGCTGTTGGACTCACCGCTGGACTCGTCGCC
CACGTCAACGTCGTTGGCGCTGGAAGTCTCGTTGTGAGCGCCAACCTGGCCCACGAACTCGTTCCACTGGCTGTCACCAGCATCGACGCCGTTCGAAGCG
GACGCCGAAGAGCCTGAGACGGACGGGATCTCGGTGGGTGCTTCAGTGGCCGGCGACTCGGTGGGAGGCTGGGTCGGTGCCTTCGAGGGCGATTCAGTGG
CCGGCGCCTCAGTGGGAGGCTGAGTCGGTGCCTCAGTGGGTGCTTCAGTGGCCGGCGCCTCAGTGGGAGGCTGAGTCGGTGCCTCAGTGGGCGCTTCAGT
GGCCGGCGCTTGAGTGGGAGGCTGAGTTGGCGTCGCAGTGGTCGGCGCCGGCGCAGTGTACTGCTGTACCATGTTCTGAGCCTCGTTCGCAACCTGCTCG
ATCGTCTGGGCTGCACCTGACGATCCGCCGGGGCAGAACGTAACCGTGAAGTCAACCGAGCTGGGGCAGGCGTGCGTCTTGGTATCATCAGCCGGGAACT
GGTAGCCGTCATCGCATCCGTCCTCCATGCACGTCACCGATACGCAGCGGTGGCCGTCCGTCTGGCTGGGCTCGATGCTCATGGCGACGTTGAAGCCCAC
ACCGCCCGTGACGGCCTTGCACTCGTCAAGGCTGCCACAGTTACCGGGGCCCTTGCCTACGCCCGTGGGGATGATACTGATGTCGTACCAGGCTGCATTG
TTGTCGGCCGAGAACTCGGCCAGCGTGGCCTGGCCCCCCGTGCCCTTGCGGTACACGTAGGCACCGCCCGGGGAGACCGTACGCGTGCTAGTGCCGCCCA
CCGGCAGCGTCTCGGTAGTCTTCGAGTCGAAGA