Description :
From Genome Similarity Track
Location :
Scaffold_68:171736- 174041
Sequence
2305 bases(100 bases per row)
TTCACAATGAAGACCGTACTACGACACAAAACGGTTGTGTTACATATTACTCCCTCTTTTTTTCATTGCCTTTCTCCCACATTGAGATACTTTCTGTTTC
ATAACGTTTGTCCATTTCGGCAAGTCAAGTTTAATAAGGAAAAAAGAAAGCTAACATTTGCTGGCCATCGTGAGGTTCTTATTCTTATTGTAATACATAT
AATTGCATATAATTAGAGATTTAAACCAATCATAAAGGAAAATTAGTGTAACTTTAGCTGAAAGTGGCGCCGATTTGGGGCAGCAATATTTGAATGAAGG
CGATTAGCTGTCTAGGCACATGTAAAGATGTTGTATAAGCCTCTGCTCATGACAATTAGTAGCGTGTAAACTTATCAATCGACGTCGACAGGATTTTTTT
GAAAATTTTGATGGTAATTTTTCCGGCTTGCGGTAACTTGATAAAACGTACGCTTAACACTGGCTGAACGAAAGCAGAATGGTCTAAGAAAGCGAAGGTG
AAACATCGAGCTTTTTTACCGATAAATGACCTGAGTAGATACGTATTAGTATACTGAGTATATGTGAATTTGTGCACATAGCCCACATGCGCAGTATTTT
TAGTTTTACATGATTACATGTACTTTTTATCAATTTTAATGTAGCGAATCTACCCGTACTCCTTTGTCAGAGGAAGACTTCTAGACTTGTAGTGTCTCTT
AGTATTTTAACTAGATGGGTATTAACGTAAGGGGTCTCAAGTCTTCACAGAATTAGTGAGACTTACCTCAAAATATCTTAGCAAGCCCGCAAGCATCTAG
TCCTGTTTCAGGGGACCAATGAATCCAATGAATCAGGTGTCATCAGTGCTCAAGAGTACTAGCCTTAATACAGGCTCTCACCTCTTACGGCCAAAGACGT
CTTAGCAAGATACGTGTCTTAGATTAATTAAAAGGTGAGCTGAATTTATACTGATTTATAGCGATAATGAACTTTACTTCCTTACTTAATCTTGAGAAAA
TGCTACCTAATGTAGGAATCCTAATATAGGTTCTTTTGATGTCACCACAGCAGAACTACAACGTACTTTGAGTGCCCGATTACGATAGATACCATCTATC
CGTAATCGATAGGGGTACGGTATTACCGCTAGCGTATTGGATACCATGAAACGCCTATCATTCCACTAATCTTTCTATGTGTGGATCACACTACACCATA
CCGGTTATACCAACCGTTTGTGTAACCCCGTTACACCCCCCACCAAATAGTCGATATCCCGAATCGACATTCTTCACCTTTCTCATAGAGATAGCTCGGA
GAGAACAGATAACCTCACGGTTGTCCTCACGACACCTTGCGCATCAATGGCGAAGTCTTCGCTCTCCCCCAAGTCTGTGGAAGACATTATACGAGAAGAG
AACATCGTCGATAAAAATGACAGCGATAATTTCGTAGAAGAGGGTGGAACCCCCGAAACTGCCACGTCAGCGTCGCGCGAACCTTCGCGAATAGCTCCAA
ACCCATTTTCAGAACGAAGTACATCTCAAGCGCTAACATCGTTGCGTGCTTCAACTACTCTTGATGAAACTATCATCACCAACAAGCTCGATGAACAACG
GCAACGATATACCGAGGAGAATAAGAGAGCTAGACGTCTATCTTAGACATTAGCTATTGCCTAAGTCCATTCGGACTATCGCTTCAAGCCATTGAGCGTT
GATGAGTTGTTGCAAAATTTTGTAGGGCAGCCTTTGACCACTTGGTCCACAGGCCTCGAGGCTACGACGTCTACCGACATTGCCAAGAGAGATGCTCTCA
GAGAGAGATACCAAACGCTAGAAACGACGTCTATCAACATTTACTAGGGATTGTTGGCGGAACAAGCACGTGGTGCCTCTGTACCCTTGAAGAGAACAGT
CCCGATAGTTCTATACCGAGGCGAGAGTAAAGACGAAGATGACAACACGTTCTCACTCAGGGATCATAGAGCACTTCTATAGCCCAGCATGATTCCCTTC
GAGCTAGTGCCTCCAAGGCCAATGTTTTTTTGGAGCGCAAAGTACGTTACTAATCGGATAAGGTAAAGGCCAAAAGCAATCTACGATCACTGTATCATAA
TCAATACGCAAAACCAGCTGCTGGTCAAACCTCCACTGTTGCGACTGTGCAGATCGTCGCGGACACTCGGTGTTGATGAGCGGACTGCACACCCCCATAC
CTATTACTGGTAAGCGCGTTGGGATACAAGCTGACCCTCAGCATGACGCTCAAAAATTCCAACGTCGTACAGCAATCTTGCCGAAGGGAGACCTCAAACT
CCCAT