Description :
From Genome Similarity Track
Location :
Scaffold_68:171735- 174069
Sequence
2334 bases(100 bases per row)
ATTCACAATGAAGACCGTACTACGACACAAAACGGTTGTGTTACATATTACTCCCTCTTTTTTTCATTGCCTTTCTCCCACATTGAGATACTTTCTGTTT
CATAACGTTTGTCCATTTCGGCAAGTCAAGTTTAATAAGGAAAAAAGAAAGCTAACATTTGCTGGCCATCGTGAGGTTCTTATTCTTATTGTAATACATA
TAATTGCATATAATTAGAGATTTAAACCAATCATAAAGGAAAATTAGTGTAACTTTAGCTGAAAGTGGCGCCGATTTGGGGCAGCAATATTTGAATGAAG
GCGATTAGCTGTCTAGGCACATGTAAAGATGTTGTATAAGCCTCTGCTCATGACAATTAGTAGCGTGTAAACTTATCAATCGACGTCGACAGGATTTTTT
TGAAAATTTTGATGGTAATTTTTCCGGCTTGCGGTAACTTGATAAAACGTACGCTTAACACTGGCTGAACGAAAGCAGAATGGTCTAAGAAAGCGAAGGT
GAAACATCGAGCTTTTTTACCGATAAATGACCTGAGTAGATACGTATTAGTATACTGAGTATATGTGAATTTGTGCACATAGCCCACATGCGCAGTATTT
TTAGTTTTACATGATTACATGTACTTTTTATCAATTTTAATGTAGCGAATCTACCCGTACTCCTTTGTCAGAGGAAGACTTCTAGACTTGTAGTGTCTCT
TAGTATTTTAACTAGATGGGTATTAACGTAAGGGGTCTCAAGTCTTCACAGAATTAGTGAGACTTACCTCAAAATATCTTAGCAAGCCCGCAAGCATCTA
GTCCTGTTTCAGGGGACCAATGAATCCAATGAATCAGGTGTCATCAGTGCTCAAGAGTACTAGCCTTAATACAGGCTCTCACCTCTTACGGCCAAAGACG
TCTTAGCAAGATACGTGTCTTAGATTAATTAAAAGGTGAGCTGAATTTATACTGATTTATAGCGATAATGAACTTTACTTCCTTACTTAATCTTGAGAAA
ATGCTACCTAATGTAGGAATCCTAATATAGGTTCTTTTGATGTCACCACAGCAGAACTACAACGTACTTTGAGTGCCCGATTACGATAGATACCATCTAT
CCGTAATCGATAGGGGTACGGTATTACCGCTAGCGTATTGGATACCATGAAACGCCTATCATTCCACTAATCTTTCTATGTGTGGATCACACTACACCAT
ACCGGTTATACCAACCGTTTGTGTAACCCCGTTACACCCCCCACCAAATAGTCGATATCCCGAATCGACATTCTTCACCTTTCTCATAGAGATAGCTCGG
AGAGAACAGATAACCTCACGGTTGTCCTCACGACACCTTGCGCATCAATGGCGAAGTCTTCGCTCTCCCCCAAGTCTGTGGAAGACATTATACGAGAAGA
GAACATCGTCGATAAAAATGACAGCGATAATTTCGTAGAAGAGGGTGGAACCCCCGAAACTGCCACGTCAGCGTCGCGCGAACCTTCGCGAATAGCTCCA
AACCCATTTTCAGAACGAAGTACATCTCAAGCGCTAACATCGTTGCGTGCTTCAACTACTCTTGATGAAACTATCATCACCAACAAGCTCGATGAACAAC
GGCAACGATATACCGAGGAGAATAAGAGAGCTAGACGTCTATCTTAGACATTAGCTATTGCCTAAGTCCATTCGGACTATCGCTTCAAGCCATTGAGCGT
TGATGAGTTGTTGCAAAATTTTGTAGGGCAGCCTTTGACCACTTGGTCCACAGGCCTCGAGGCTACGACGTCTACCGACATTGCCAAGAGAGATGCTCTC
AGAGAGAGATACCAAACGCTAGAAACGACGTCTATCAACATTTACTAGGGATTGTTGGCGGAACAAGCACGTGGTGCCTCTGTACCCTTGAAGAGAACAG
TCCCGATAGTTCTATACCGAGGCGAGAGTAAAGACGAAGATGACAACACGTTCTCACTCAGGGATCATAGAGCACTTCTATAGCCCAGCATGATTCCCTT
CGAGCTAGTGCCTCCAAGGCCAATGTTTTTTTGGAGCGCAAAGTACGTTACTAATCGGATAAGGTAAAGGCCAAAAGCAATCTACGATCACTGTATCATA
ATCAATACGCAAAACCAGCTGCTGGTCAAACCTCCACTGTTGCGACTGTGCAGATCGTCGCGGACACTCGGTGTTGATGAGCGGACTGCACACCCCCATA
CCTATTACTGGTAAGCGCGTTGGGATACAAGCTGACCCTCAGCATGACGCTCAAAAATTCCAACGTCGTACAGCAATCTTGCCGAAGGGAGACCTCAAAC
TCCCATGAGTTCTCAGACTCAGCTTATCCACGCC