Description :
From Genome Similarity Track
Location :
Scaffold_182:17172- 20298
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_182-fgenesh-gene-0.8Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_182-snap-gene-0.16Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_182-fgenesh-gene-0.9Nucleoredoxin

Sequence
3126 bases(100 bases per row)
GCGGCGGTCGATGGCAAAGTCGAAGCCCACGGGTTCCGTCAGCTTGGCGCGGCGCACGGCCGGCACGCCGAGTCCTCCGCTGGCCTGCAAAGCCTGCATC
ATTGCATACACGAACGTGAGTCAACCCAAATCCACCTCGATTGTTCAGCATACAACTGGGGGAACGCACCACCGTGAACTTGGCGTTGTCCTTGGTGCGC
GGCACGGACGGGAACGCGCGCGTCGTCTGCTCGTGGTAGCGCCGCGTCTTGTTGCGCATCGAGGCCACGCGCTGGCGGATGGCGGCAATCTCCTCGAGCT
CGCGCGACGTCATGGTGAGCTGTGCGTTCCGGAACGACGGGCGAGCGCGCGGGTGCGGGTGGAACTTGGGCGACTGCGGGATCGTGAGCCGCCCGTTGGC
CTTGGCGACCTTGGTGAGCCGCCGCNNNNNNNNNNNNNNNNNCCTTCTCCTTCTCCTGCCTGGTCAGCGCCTTGGCACGCGCTCGCACGAGCGAGCTCTG
CGTCGGCGCCAGCAGCCGCGCGGTGGGGGCGATCGCGCGCACGCGGGCCNNNNNNNNNNGCGGCCGTCCGCGGTACAGCGCGCTCGGGTCCTCGTCGAAG
TTCTCGCTCGAGACGTGCACGGCCATGGCGGTGGTGCTCTTGTCGAGAGGGCGGAGGAGGGAGGGTTTGAATTCGAAATGTGTCAATCGAGCGGCCTTTC
TTGACCGAGTTTTTCAAACGTTCAAAAGTGAGGGAAGACAAAAATAGAGCGTTTCAGCCAATCGTCGCGCTGTATTTATGTCCATCCTTCCGAATTCATT
GGATGAAATAGACTCAAATATTACGTCCGAGTAAAAATGGGTGATTTTATTTTATCACCACCCAAACGTTACTCTTTTTTTACCGACTGAAGCGTCCGAT
GCTCTCTATCTTTAGCGGTTGAAGTTGCTGCCCAAACGCGGCAACCATGCGCGTCCACCTCCAACTTGCTCGGCGCCATGGGCGAGCGAGGGCCAATGCG
CGGTGGCCGCCGGCTGCTCCTGCGGCGAGCGGACGAGCCTGCGCCTCACCATGACGACGTGCCGGCCGTGCGCGAGCTGCATGTGACCATCCCTCTGCGT
CCGCAGGCGGTGCCGGCCAAGTTCCCAGCACAGTTCGCGCGCGCCGTCCAAGACGAGTACGCGATCCAGTACCTGGCGCAGCTCGGAGCGAGCGGGACGC
CGGAGAACGTGGCGCTAGTGCTGCAGCACCTGCCGCTGGAGGACTGCGCGGTGGCCGCGTCATGGCGCGCGCGCGGCTCGCTCAGCGACATGCTGTCCAT
CGACCTGTACCCGCCAAAGCACGGACCGTCGACCGCTATCGTGCCAGTTTCTCCGGCATCTAGACCCTCAACTGTCGCCCCAGTTGAGGCGATATCTCCC
ACGCAGAGTCGCATCTACTGCGTCGGACACGTGTGCTTGTCGTTCGACGACATGAAGCGCAAGTTCCTGCTGCCGTTCTGCCAGGCTGAGACTCGGGAAG
AAGTCGACGTGCTCGCCACGTACGGCATGAAGCGCGTTGAGGACGGGTCTGCGTTCGTCCAAGTGCCTGTGCTGACTGACGCAGACGCTAAAGCAGTCGG
GCCGATTGGCGTGTTGACGAAACGAGCGTCGCAGCGTCGACACCTATGTCACCGAGAGCGCAGCTCGCCCCCAGACGCGAGACCTGACACCATCATCTCC
ATGCACAAGGCTTTTTTCTTGGTGTTGCCGCTCTCATCGCTGGGCTTCTCGGCACGGGATGATCGAGAGCAGGCGCTGCTACTGGATTTGCTGCAGGGCG
ATGATATGCTCGCGCTCGTGCAGGCAGTGAGTCTGTACCTGTACGTCGACAAGTTCGTCTGGCTGGCATCCGTGAATGACCCCAAATTTCCGTCGCCGCC
GCCGTCAACGTCGCAACTGCCCAAGGTTGAGACGCTGTTCGTCGACATTGTCACGAGGTTCGAGGCGCTGCGCTCGCGACTCGAACATGAAAACCTGAGC
ACCAAAAGCCGAACAACGGCGTCGTTATTGCTTCCGCTGCTGCTCCTGGCTCTCCGTATTGATATCGAGACGATGTACCGAGTGCAGTACCCGCAGAGTT
TCGCCATGGCCGGACCGACAATGCAGTTCACATTGCGCGAGATGAACAAGCGAGTTACCGAGCTACTAGATCCAGACACTCACCTGAGCCGACTTGCGAT
CCTCGAGACATCCTGCAGTGGCCTAGCGGCGATGTCATCGCCTGCGTTTCAGCAACGCCAGCGCACGCGGCGACTGCGCGACCAGTTCTTCAAGACGAGT
GAAGCACTGCACAGCGTGTTCCCGACGCAAGTCGGCGGACGCTCGCGCCAGATCGCTTCGCAGAATGGCGGTGCTAACATTGCGCGGTACGCTCAGCACT
TGGACCGCGACGCACAAGCTGCGAACGATCGAGAAGAGTTTGAAGACGTGCGTAGACAAAACAGCTCAACGAACACATCTGTCGAGACGAAGCTCAAGCT
GTTGCGAGTGCTGCAGCGGAGTACTCCGGTCTGGACGACGCGGTAGTCAAAGACAGATTGCGATATGACAACAAGACGCTACGAAGGGGAGAAAGCAAAG
TGTTGACATGCAACTCATGCTAGAAATTCCAACGTAACCACTGGCGCGAATGAACGGCGACAGGTTGACATCGCCCGGATGCGCTGCTTACTGACCAAGC
TGAGCCCAGAGCTTCTCGACGTCTCCGTTCGAGCTGGCGACGAGCGTACGGCCGTCCAGCGTGATGATCTCCCCCTTGTCGTTCAGGAAGATGAGCATCG
GGATGCCGGTGACCTGAAACTTTTCAGCGATCTCCCGCTCCTTGGCGCGGTTCTCGAACGGCATGGCGACGAAAGGCATCTCGCCAAAGTACTCCTCGAA
GCTGCCCGAGTCACGGTCGGCGGAGACGAAGACGAGCTCGAACTCCGGGTGTTGTTCGGCCATGTCCTCGTACACCGTCGAGAGCAACGGCGTGAAGCCG
CGGCACGGCGGGCACCAGTGCGCGCTGAAGTACACTCCGACAACCTTCTTCCCGCTCAACACTTCCCCCGTGGCCTTGAGCCCGTCCTTGGTCTGGATCT
GGTCGCCAAAGAGGTCCGTCCACGTC