Description :
From Genome Similarity Track
Location :
Scaffold_1035:1717- 6755
Sequence
5038 bases(100 bases per row)
ATAAATTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGC
GCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGCTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACCTGA
ACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGT
CTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGATGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCC
CAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCTC
TAGACACTGTTAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACTATTTGCAGTCCTGTCCAGACATGGTGCGTCGTACACCATCGACCT
GCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCA
GCTCCTCGAAGCGAGGGCCGGTCACACTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGC
CGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTTAGGGAGTGTGCCGCAGGC
GGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGC
TCGCGACCTCTCGCTCCACCAGGTCCATGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCC
AAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCG
GGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTTTCGAAGCAA
CGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGA
AGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTCCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCG
CGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGT
CCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGA
ACTCCATGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCC
TTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGC
CCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGA
GTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACTGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAG
ACCTCCCGGGGCTCAACGATAGAACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCTGATAGGAGCGTCGAG
TCTCCTTCTCCTCGCGGAGTGGCGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGC
AAGCGAGCGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTG
GGACTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCAT
CATGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGG
ACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTG
CCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCG
AAGTGGAGACCTTAACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGA
CTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGT
GTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAA
CCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCTCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTT
ATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAG
GTGCTGTGTGACCCCGTCACAACCGGGCAGCTGAGTTCACACAGGATGAAGCTACGGGGAAGTGGGTCCGTCGCATCAAGTCGCGCGACTCTCCTTCAGA
GCTTGTGGAGAAATTCTCGGGCTAACGCCTCTCTTCTCAGCTTCTCGCGTTACTGCAAGACGCTTATCTTGGGGCTGGTTCGAAGATTGCAACGAAAGCA
ACACCTCCGCTTCAAACCTCACATAGTTCCCTGAGATGAACAAAGGGTCTTTCCAAATAGGGTGATCGGGAAATTTCCTACGTAGCACTACCGAGTCTTG
AAGAAACATTACTCTAAAAACGTGCAGCAATCCAATCAATCCTCCTACAGCAACTTCCCGGCTTCCAGACTCGCGAAGGTCTCTCTCTGTCAAGAAAAAC
CTTTCGTAGTAGCTCAACAGGTGGGGTTATTGTGGCAAGATCTAGCCAATACCCACCCGCCTTTGTCTGGAACCCTGCCAAAGCGCGCATTGCCTTTCGC
GGTAGTGTTGTTAAATAGCACGCTTCCATTTCTCTCTCCATTCCATCTACCAGCTCGCCTAATCTGGTTTTCATCCGCGCCTTGTAGCTCAGCCAGCTTG
GATCCTGAGCCCGGATTGGCCAGCGTTCAGACTGACGAATCGATACCACATGCCCTAAATGCAGTCTTCACGCTTTCTAATTGCGTATTGTACGCAATAT
CACACATTGCACCTTTTCGTTTTAGCAGACGGAGATCGTACTAGTGTTTTCGATCGGTAAAGCGAGGAAATGACTCCAAATCCACATGCCATCTCCAGAA
CAAGTATAGGACCACCGCATTTAAAGGGCATAACATCACTTCTTTGCATCGCATAGCTTCAAGTTTCGGCCTTTGACCCGTGCCTCTACATCAAAGTTGT
TGATGGTCACTGTGTGCTCATACTGGTCTACGTCGACGATGCCATGGTCACCGGAAGCTCACCCGAGCTGACCTCACGCACGAAGAGCGATCTTAAGACA
CGCTGACTCCACCCCTTTCGGGTTTCGGTATTCGGGTAAATCCATAGAGGGCGCTATCGATCAGGCGTTGGTAGATCTGGGGCGCATTCTTCAATCCAAA
AATGACTGACAGCGGCAAGTGTGTGCTCGTCTTTGGAATCGAATTGGAAGACGGCCCAGACGGCAGCGTGACGATGAGCCAACGGCGTTATGTGGATGAA
ATCCTGAAGCGTTTGGGTATGGACGCGTGCAAGGCTGTGGTGAGTCCGGTGGATATAAGCGCTCGACTAGCTCCAAGAGACGCGGCGACCAAGGTACAAG
CTCCGTTTCGCGAAGCTGTTGATGCACTAATACACCTGATGACCGCGACGCGTCCAGATATTGCGTACGCGGTGGGCTATGTGTCGCGCTTTATGGAGAA
TCCCCAAGAAGAACACTGGGTTGCGGTCAAGCGCATTTTTCGCGACCTGCAAGGCACCAAGACGCATGGATTCTGATACAAGTCGGGTGACAACATCGAC
TTTCGCGGATACTCTGACGCAGACTGGGTTGGTGACCTCGTGGACCGCAAGTCGACTTCCGGCTGCACGTTATACTGATGGGTGCGTCAGTGAGATGGGG
TAGCAAGAAGCAGTCAAGTGTCTCGCTGTCTACGAGCGAAGCGGAGTACATAACGATCAGTCTAGCAGTTCAAGAAGGCAAGTGGATCCTCTAGCGTGCT
GTGCGAGATCTTAGCAGCTGCCAAGCCGATAAAGCATA