Description :
From Genome Similarity Track
Location :
contig_45:171691- 172953
Transcript NameFunction/comments
g9466.t1hypothetical protein

Sequence
1262 bases(100 bases per row)
GGTGCAGTTCTGGGCCGAGGTTTACTACAACGCAGTGGATAGACTGTCGACACTCACGGACGTCGTCAAGCCTGCGATCCGATGGTTCATCGCGGTGTGT
ACACACATTGGCTGGAGGGGAGTGATGGGGACACTGACGAGTTGATGTTGTACATACAGATCGTGGTGCTCATCCAAGGACTCTTTTGGGTCTTCTACGC
ATCGGTCTGGCGTAACGAGCGTACGTACTGGGTTGTGCTGGTGTAGCTTGTCTCGTGCCAGTTTCTGACGATTGTTCGCATGCTGTGGGTTCGTGTAGGT
GCATTCTTTACCAGGACGCAAGCAATTTTGAACATGGAGCTGTTCCTGATTATCGCCACAGGCTTTATCTACTTTGGGCGAAAGGCCTACATTGAATTGC
GGTAAGATTTTATGCGTTGCAGTAAGTAGAAGGCTTGCATCAACTGACCAACGATTATGCGGTATTACTTGCGATGTGTTGGTAACACCCAGATCAGTGC
CAGTTGAACTTGGAATCCGCTCGAGAAAGCTGAAGGAGCTCGTGATTATGACATCAGTCGGCACGTCCTGCTTTATGACGCGCTGCGGATTACAGATTGT
CCTGTCAACGGAGAAGAAGCAGCTACATGATCGCACCACGTGGCTTGTGGTCGTGGTGTACTATGCCCTCCTTGAAATTGTGCCGGCACTGTCAGTTTTG
TACTTCAACCGCCGACTTCCTCCTCGTCGAAGGACTGGAGGCCTCTCTGCGACCTCAAGCCCCATTCGAGGTGGCAGACTCTTCTTTGGCAAGGGCATGG
GCGCCGATAGCGCATCCGACGGAGTTGATCCGTTGAGAAAGAGTTTGCTTCGGGGGGTAATTCGCGAAGTTTTGATAATGCCACGAACGCCACCAAGTTC
TGTTTCACGGGTTTCGGTAGCTTGCTATAGCTGCAGGCTGCAGCATTATTCAGAACATAAGAAAATTCAACTGAAAGTGAACTTCCAACCGCAAAATGAC
CGAGGCAAGTAGTTTGCGGCACAAAATATGTGGCACGTGCTTGGATGGTGGTTTGAATTTCGAATGATACCACGAACTAGCACTCAGGTATGGGTCCAAT
CACCATTTGAATTACTGCTCACCCGACACTTCCACAAGCAGCTCGAGCATACGGTCATTCTCTTCGCGAGATCCGATCGTCGCACGAAGGCAATTGGTGA
GCAAGTGCTGGTTGCCGCGGTAACGAATTACTACGCCACGACCAGCCATTTGCCGGTAGACA